Entry information : PtRboh03 (POPTR_0003s13310 / Potri.003G133300)
Entry ID 6079
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2010-07-15 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: PtRboh03 (POPTR_0003s13310 / Potri.003G133300)
Name (synonym) PtRboh03 (POPTR_0003s13310 / Potri.003G133300)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh03
start..stop
S start..stop
PtRboh02 1843 0 1..948 1..949
CcaRboh05 1682 0 1..948 1..945
CcaRboh01 1682 0 1..948 1..945
CsRboh01 1678 0 1..948 1..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13700926..13701583 658 N° 2 13701824..13701983 160 N° 3 13702392..13702440 49 N° 4 13702927..13703040 114
N° 5 13704201..13704623 423 N° 6 13705399..13705785 387 N° 7 13705871..13705966 96 N° 8 13706102..13706217 116
N° 9 13706591..13706758 168 N° 10 13706867..13707026 160 N° 11 13707134..13707331 198 N° 12 13707420..13707548 129
N° 13 13707722..13707800 79 N° 14 13707888..13707997 110  
join(13700926..13701583,13701824..13701983,13702392..13702440,13702927..13703040 ,13704201..13704623,13705399..13705785,13705871..13705966,13706102..13706217,137 06591..13706758,13706867..13707026,13707134..13707331,13707420..13707548,1370772 2..13707800,13707888..13707997)


exon

Literature and cross-references PtRboh03 (POPTR_0003s13310 / Potri.003G133300)
DNA ref. Phytozome 12:   scaffold_3 (13700926..13707997)
Cluster/Prediction ref. Genebank:   18097047
Omic ref. ePlant:   Potri.003G133300
Protein sequence: PtRboh03 (POPTR_0003s13310 / Potri.003G133300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   948
PWM (Da):   %s   107363.64 Transmb domain:   %s   o386-405i525-547o567-589i746-763o
PI (pH):   %s   9.81
Sequence 989
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGSLPKHERRWASDTVPGNATMSAGTSPGTESGEEFVEVTLDLQDDNTIVLRRVEPATSTVINIDDVSFTPGGSVSAGAVTPVSRSPTIRRSSSNKILQFSQELKAEAVAKAKQFSQELKAELRRFSWTHGQAARVLSASGNSGGGFESALAARALRKQRAQLDRSRSGAHKALRGLRFISNNSAKTNGVDAWSEVQSNFEKLAKDGYLYRADFAQCIGMENSKEFAVELFDALGRRRRLKVDKISRDELHEFWSQITDQSFDSRLQIFFDMVDKNEDGRITEEEVKEIIMLSASANKLSRLKEQAEEYAALIMEELDPERLGYIEIWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRKRSPIRRVSKRCVYFLQENWRRIWVLALWVMIMIGLFTWKFLQYKQKNAFHVMGYCLLTAKGAAETLKFNMALILLPVCRNTITWLRSTKLGHLVPFDDNINFHKTIAAAIVIGVILHAGNHLACDFPKLINSSDDTYEQYLRNDFGGKKPSYAKLVRGAEGVTGILMVISMAIAFTLATRWFRRSLIKFPKPFDRLTGFNAFWYSHHLFVIVYILLIIHGVFLYLVHKWYKKTTWMYLSVPVLLYAGERALRFFRSGFNTVRLLKVAIYPGNVLTLQMSKPPQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSVHIRQLGDWTQELRRVFSEACECPVAGKSGLLRADETTKKILPKLLIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEQADLVSDISRTSDLSIGSNDNSSSNKVSTKRKKAVRTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLSKLCSKHCNARIGVFYCGAPVLAKELSRLCYEFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 13 introns). ESTs from hybrids.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGAGGTTCATTGCCTAAACACGAGCGGCGATGGGCCTCAGACACGGTTCCCGGCAATGCAACGATGAGCGCCGGGACATCTCCGGGAACTGAGTCCGGCGAGGAGTTTGTTGAGGTAA
CACTTGATTTACAAGATGACAACACTATCGTCCTTCGCAGAGTTGAGCCAGCAACATCTACGGTTATCAACATCGATGATGTTTCTTTTACTCCCGGTGGTTCGGTGTCTGCCGGAGCTG
TAACGCCGGTCTCAAGATCGCCGACGATCAGGCGGAGTTCGTCGAATAAGATTTTGCAATTTTCTCAAGAGTTAAAAGCTGAAGCTGTAGCCAAAGCTAAGCAGTTTTCGCAAGAGTTGA
AAGCAGAGTTAAGGAGGTTTTCTTGGACTCATGGACAGGCTGCTCGAGTGTTATCAGCTTCGGGAAATAGCGGCGGCGGTTTTGAGTCAGCTTTAGCTGCTCGTGCTTTGAGAAAGCAGC
GAGCGCAGCTGGACCGGAGTCGGTCTGGTGCGCATAAAGCTTTGCGTGGATTGAGATTTATAAGTAATAACAGTGCAAAAACAAATGGGGTTGATGCATGGAGTGAAGTTCAAAGCAATT
TCGAAAAACTTGCTAAAGATGGTTATCTTTACAGGGCCGATTTTGCACAATGCATTG
GTTTGATTCTACTCTTACTCCTATTTTCCTACTGGTTTTAGTAGTAGCTGTCTCCGCACCACC
TTTCATGTTACCGAGTTTAGATTATTATTATTATTATTACTGCTACATTTAGACAATTATAGATAAAAAGAAGAAGAAAAAAAGTAAGCGCAGCAAGAATATTGAAGATTCAGTTGTTAA
GTAGTCATAATGTCTTGTAAATTAATTATTGAAATAAATGCTGTTGTGCTTTGAAAGGAATGGAAAATTCGAAGGAATTTGCTGTGGAGCTTTTTGATGCCTTGGGGAGGAGGAGGAGAT
TGAAGGTGGACAAGATTAGTCGAGATGAGCTTCACGAGTTTTGGTCACAAATTACCGATCAAAGCTTTGATTCTCGACTCCAGATCTTCTTTGATAT
GTACGCATCGTCGTTACATTTAT
TATGGGCTCTACTATAACTAAACTAAATTAACGACTTCTTTAATTCCCTAGTTAACCCGTCACTTTTCTTCTTCTTCTTCTTCTTTTAAAAAAGAAAAAAGCTTAACTGAGATCAGGCAA
AGCAAGGAAATTGAGTTTATATATACTCCACCGAACAGAGACGATCAGAGGACAAGAGTGTCTTTTCATCTGAGCCCCAATTATTGAAAATGTGATTAAACAACATTGACTTATTATCTT
GGCCCCCTCTGAGATGGCATCTATGAACGAGTCGGCATAATTTTAAATAGATGAGCAAACCTAATCAAATTAAAGTAGGTTCACTGATTTAGTATTTAAGTTGTTTTAAGTAAACTCTTT
TTGTTGTTGTTATATGTGTTTACAGGGTGGACAAGAACGAAGATGGTAGGATCACCGAAGAAGAAGTGAAAGAGGTATCCAGATTAATTAATAAATCATTAGCTTATCTCTTTCAAAAAT
CCATTTTATTTTTCTCTCTTAAAGTGTTTAGTTTTAACTTAACGTGCATGAATTAGCCAGCACTCTGTCAGGTCCTCCTTGCAGACATAAAATAAGAGCTGACCTTTCCAGGGCTAGAGA
AATTAAATCCAAAATGACCCCTTGATTATATCAGAACTATTGCCCTATCTCTTTAATTGTAAAATAAAATAAGATTCGGCCCTATATCAATAATCGCTGAGGATTCGGTGACCATAAATT
CTTGGAGGATCTAAAACTAACCACTCCAAACACGAACCCATTTTTTTCTTAATCTCTGACGCAATTCCCATGTCAACAAGCATCTTTAACTTGAAGGGAAAAATGTTTAATACAGGGGGG
AGGGGCTTCTGGAGCAAAAGTCTTTAATTTGCGCGATAAATCTGTTTATTAATTTGTATTTTCTTTACATAAATTGGTAGATTATCATGCTAAGTGCTTCTGCAAATAAGTTATCGAGAT
TAAAAGAACAGGCAGAGGAATATGCAGCTTTAATCATGGAAGAGTTGGACCCTGAAAGACTTGGCTACATCGAG
GTGGGTCCTCTTGAGTTTTAATTTCATATATATATATATATATTTT
TTCTTTTATTTTTAACATGCATGCTGGAAACTTTACAGTGATTCTAGAAGGAGTTAGGTGGGCTTAATATAATATTCATCTTTAATATTGTTTCATTTTCATTTCAGTTCCCATCATTAG
CTAAATAAATTTGTTTAATCATAGTCAAATTGATCACTTGTCTAGTTTCGGGTCATAATTACAATCTTAATAGGAAAATAATAAAATTAAATAAAAAATTAAAGACAGGCACAGCATTTG
CGTTAGACTTCTTCTTCTTCTTCTTCCAAAGTCCATTGTTAGGCAACAAAGCCTAACAGATTAACTTACCAAATCTTGATGCTTCACAGCGTTGTTGTTGAAACGCGCAAGAAGAAAGAA
TGAGACAGGAAGAGGAGAAAAAAAGTTTATTTATTTATTATTTTTTATAGATGGCGTAACTAATAATTTGGTTAAGTAAGATTATTTATGTTTTCAATGTCTTGTCATTCCTCTAATCTT
CAAAATCCAGCAAATTAACCTTGTAGATTTTTGCAAGCCCAATTTCTATCCCTGAACCTTTATCATTTCAAATTATCACCTCTTGTTTGAATTCAAAGAAATACCTAAAAAAATATTATT
CCCTAATTTAAAGTGTCTTGGTGACCAATACTCTTATTCCCAATAAAACATCATTTTTCATAGAGCATATTTAAGATATGAAGTAAATATTATTTTTTAAAATATTTTTTACTTGTAAAC
ATATTAAAATAATATTTTTTATCCTTTTAAATTTATTTTTGATATTAACACATTAAAATAATAAAAAAATATTAAAAAAATTATTTTTAATTTTTTTTTCAAAATTTAATAGAAAATAGG
TTCACCTCGAGCCCCAAACAAGGTTTAATTCCATAGTTGATAATTTGAAAATCATTCCTGCCACAGTTGACCTGAGAAACATAGATGGATACCCGAGTGGACTAACGGTGTTTGCCTCGA
ATAATGCTTGGCCTTCACTCATACATTATGCATTACGCGTGTTGCATTGCGCATCAGTTGGCACGATCCATCTTCTCTTGTCCCCTAGTAATTCCATTGCTGATGATTTTGTTGCAATCT
TGTTTTTCTTTTTGTTGCTGAAAATGATATAAAGATATGGCAACTAGAGACACTTCTTCTACAAAAAGACACGTATCTGAACTACAGTCAAGCTCTAAGCTACACAAGCCAAGCCTTGAG
CCAAAATCTACAGGGGCTAAGAAAGAGAAGCCCGATAAGGAGAGTGAGCAAGCGATGTGTATACTTTTTACAGGAGAATTGGAGGAGAATTTGGGTTTTGGCATTATGGGTTATGATAAT
GATTGGATTATTCACATGGAAATTCTTGCAATACAAGCAAAAAAATGCTTTTCACGTCATGGGTTATTGCCTCCTAACAGCTAAAGGCGCGGCAGAGACATTGAAGTTCAATATGGCTCT
AATTCTCTTGCCTGTGTGTAGAAATACTATCACTTGGCTTAGGTCCACAAAGTTGGGTCACTTGGTGCCTTTTGACGACAACATCAACTTTCACAAG
GTATACACAAGGTTACCTACCAC
CTCCTCTTCTTCTCTATATTGCTTTTTTATCACGTTTACGTCCTTTGGGGTCCCTCACGGGAGACTTTCGCTAGAAAGTCAACACATTGGTTGATCTTTAGCCATGAAAAGAGAATAATT
TGCGAGCACCCAAACAGTGGTCATCATGAGGGATATTTATCAGATGCGATACGTCAACAGGCAGCAATAGTTGACAACTATTAGGCTTTCATACTCTTCTTTTTTCCCATTAGATAATGT
TAATTGTTGACCACAAAAACAAAAGGTGAAGTCCAAAAAAAACGCATGCTGGACCAAAACAAAAAACAAAACTATTTTAGATGTTTTAGTGGTGGTTTTAAAAAAAAAGACAAGAGCTTT
ACGAAGGTGAAGTACTCATCTATCCATTTATTTCTGGTAAAAATATCATCCTTTAATTTCAAATCCAATAAAACTAAGTCAGTGAACAATTAAGTGTTTTTTCTTTTATCTAAATCATCA
TTTAAAAGCCATCCTTACGCTAGCTAAGACCCAAATGCCTGTGTCATATAAAACTGAAGAGCAAATTTATAAGAAGCTCATAACTAGCTAGTCCAAAGCTATTTTACCATTGATGAAAGA
TATATATAACAATAAATAAATTCAAAGAAGCTTAAATGAGTTTATTGCTGTACAAATTGACACCATCTAATTGCAATGGATTGTCTTAGAAGACATTCATTCATTTACTTACGGTAAATT
ACTTTGATTTAATATTTCTTACATACATGCAGACCATAGCAGCAGCAATTGTAATCGGGGTGATTCTCCATGCTGGAAACCATCTAGCTTGTGATTTTCCAAAGCTTATAAATTCATCTG
ATGATACCTACGAACAGTATCTGAGAAATGACTTTGGTGGAAAGAAACCTTCATATGCAAAATTGGTTAGAGGGGCTGAAGGTGTGACTGGAATTCTTATGGTGATCAGCATGGCAATTG
CATTTACACTTGCTACAAGATGGTTCAGGAGGAGCCTCATTAAGTTTCCAAAACCCTTTGACAGGCTTACTGGATTCAATGCATTCTGGTATTCACACCACTTGTTCGTCATTGTCTACA
TCTTGCTTATCATCCATGGTGTATTCTTGTATCTCGTGCATAAATGGTACAAAAAGACG
GTATGCATCAGAAATCTTTTCCTTACTAGTTTTAACAGCAGCGAGTGTTCGCGAGAGTAAA
CTGACGGTGATTTCTTGCTTGCAGACATGGATGTATCTTTCTGTTCCAGTTTTACTATATGCAGGAGAAAGGGCCCTCAGGTTTTTTCGTTCTGGCTTCAATACTGTCAGGCTCCTCAAG
GTATAAAATCTTGAAGACCTCGGTTTGATCTTTTTGAAAGAGCCGTATAAAGTACTGGAATACTTCTGTAAAGTTGAAGACCAACTGTACTAGATTTTTGTCTATAATAGTATCTTTTTT
CTTCCTTACATTCAGGTTGCAATTTATCCTGGAAATGTTCTCACATTGCAAATGTCTAAGCCTCCCCAATTCCGATACAAGAGTGGACAGTATATGTTTGTCCAGTGCCCTGCTGTTTCT
CCATTTGAGTG
GTAAGTCACTATTAATTTATCAACTCACGTGAAAATACATGTCATTTTCGGTAGTTTACAACACTTTCAGCTGTAGTTCAAAAGATTTTCGGTCGTCAAATACATCCAG
GGAAACTGCTAACAAGAAACTTGCTCATCATATGCTTTAAGCTAATGTTATGCTTATTGTCTTTATGAATGCTCGTATTTCGGAGTGATTAATTTCATTAGCTGATGAAAGCTAGTGAGT
TTTTTTTGGCAGGAATCAGTGATTGCTTTCTTAAATTCCGTGGTTGTTGATCAATTGATACCACCAATGTGAATTAGTTTCTATGTTCTGATACCTGATTTGCATTGTAACTTAATATGA
GCATGCTTTTATTTTTCCACCCAGGCATCCATTTTCAATCACCTCCGCGCCTGGTGATGACTACCTTAGTGTTCACATTCGGCAGCTAGGTGACTGGACTCAAGAACTAAGAAGGGTATT
CTCTGAAGCCTGTGAATGTCCCGTGGCCGGTAAGAGTGGACTTCTCAGGGCTGATGAAACAACAAAGAAAAT
GTACGGAATATGTCTATACTAATTTCCTTTCCTTTTCTCATTCTATTT
TCGCCTTTGGATACCGTTTTCTGATTATATTGTTTATGTAACATTCTTCTCTAATGACAGTTTGCCGAAGCTCTTAATAGATGGGCCTTATGGTGCACCAGCACAAGATTACCGCAAGTA
TGATGTGCTGCTGCTTGTTGGTTTGGGAATTGGAGCAACACCTTTCATCAGCATTCTAAAAGATTTGCTTAATAACATTGTCAAAATGGAGGAGCAGGCA
GTAAGTGACAAGAAAACTGA
CTTTAACTTTCCAATCTACAATAAAATGTCTCTTCATCCACGGTAATCTCTTAAATGCGTAGTCACAAGTCTGATTCTTATTCTCAGGATTTGGTCTCGGATATCAGTAGGACATCAGAC
CTGAGCATTGGAAGTAATGATAATTCATCCTCTAACAAAGTTTCAACGAAACGTAAAAAGGCTGTAAGGACCACCAATGCTTATTTCTATTGGGTAACAAGGGAGCAGGGCTCTTTTGAT
TGGTTCAAAGGAGTCATGAATGAAGTTGCAGAGCTTGATCAAAGG
GTAATTAATGTCCATTTAAGTAAATTAGAAAGATTTTTCCATTTTGCTTCGTTTCCTTGATTGTTGACTTGTCAT
TGGACTACTCCAGGGTGTGATTGAGATGCATAATTACTTGACCAGTGTGTATGAGGAAGGAGATGCCCGATCAACCCTCATTACCATGGTCCAAGCCCTAAACCATGCGAAAAACGGTGT
GGACATTGTCTCTGGCACCAGG
GTAAGACCAATCTTTTTGTTTCAGGCTCCTCGTATGTTCATCTTGTGGGTCCTAGGTTATATCAGCAGGAATTTTCCAAAATTTCTGGCACCTTCAAA
GAGATATAAGTTACATTCTCAGCAGGCAAGTGACACCATGCAGTTCTACTAACAAATCCCAAACTTTTTCTTTAGGTGCGAACGCATTTTGCAAGGCCTAATTGGAAAAAGGTTCTTTCT
AAATTATGTTCCAAGCACTGTAATGCAAGGATAG
GTGAGTGTTCCTTCCAGCCAACATAATTCTTTTCAATAAAGAAACCCATCATTTTGTTCTAATTATATCACTGTGGTTCTGGAGCA
GGCGTGTTTTACTGCGGGGCACCTGTCTTGGCCAAGGAATTAAGCAGGCTCTGCTATGAATTCAATCAAAAAGGTTCCACAAAGTTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGAGGTTCATTGCCTAAACACGAGCGGCGATGGGCCTCAGACACGGTTCCCGGCAATGCAACGATGAGCGCCGGGACATCTCCGGGAACTGAGTCCGGCGAGGAGTTTGTTGAGGTAA
CACTTGATTTACAAGATGACAACACTATCGTCCTTCGCAGAGTTGAGCCAGCAACATCTACGGTTATCAACATCGATGATGTTTCTTTTACTCCCGGTGGTTCGGTGTCTGCCGGAGCTG
TAACGCCGGTCTCAAGATCGCCGACGATCAGGCGGAGTTCGTCGAATAAGATTTTGCAATTTTCTCAAGAGTTAAAAGCTGAAGCTGTAGCCAAAGCTAAGCAGTTTTCGCAAGAGTTGA
AAGCAGAGTTAAGGAGGTTTTCTTGGACTCATGGACAGGCTGCTCGAGTGTTATCAGCTTCGGGAAATAGCGGCGGCGGTTTTGAGTCAGCTTTAGCTGCTCGTGCTTTGAGAAAGCAGC
GAGCGCAGCTGGACCGGAGTCGGTCTGGTGCGCATAAAGCTTTGCGTGGATTGAGATTTATAAGTAATAACAGTGCAAAAACAAATGGGGTTGATGCATGGAGTGAAGTTCAAAGCAATT
TCGAAAAACTTGCTAAAGATGGTTATCTTTACAGGGCCGATTTTGCACAATGCATTG
GAATGGAAAATTCGAAGGAATTTGCTGTGGAGCTTTTTGATGCCTTGGGGAGGAGGAGGAGAT
TGAAGGTGGACAAGATTAGTCGAGATGAGCTTCACGAGTTTTGGTCACAAATTACCGATCAAAGCTTTGATTCTCGACTCCAGATCTTCTTTGATAT
GGTGGACAAGAACGAAGATGGTA
GGATCACCGAAGAAGAAGTGAAAGAG
ATTATCATGCTAAGTGCTTCTGCAAATAAGTTATCGAGATTAAAAGAACAGGCAGAGGAATATGCAGCTTTAATCATGGAAGAGTTGGACCCTG
AAAGACTTGGCTACATCGAG
ATATGGCAACTAGAGACACTTCTTCTACAAAAAGACACGTATCTGAACTACAGTCAAGCTCTAAGCTACACAAGCCAAGCCTTGAGCCAAAATCTACAGG
GGCTAAGAAAGAGAAGCCCGATAAGGAGAGTGAGCAAGCGATGTGTATACTTTTTACAGGAGAATTGGAGGAGAATTTGGGTTTTGGCATTATGGGTTATGATAATGATTGGATTATTCA
CATGGAAATTCTTGCAATACAAGCAAAAAAATGCTTTTCACGTCATGGGTTATTGCCTCCTAACAGCTAAAGGCGCGGCAGAGACATTGAAGTTCAATATGGCTCTAATTCTCTTGCCTG
TGTGTAGAAATACTATCACTTGGCTTAGGTCCACAAAGTTGGGTCACTTGGTGCCTTTTGACGACAACATCAACTTTCACAAG
ACCATAGCAGCAGCAATTGTAATCGGGGTGATTCTCC
ATGCTGGAAACCATCTAGCTTGTGATTTTCCAAAGCTTATAAATTCATCTGATGATACCTACGAACAGTATCTGAGAAATGACTTTGGTGGAAAGAAACCTTCATATGCAAAATTGGTTA
GAGGGGCTGAAGGTGTGACTGGAATTCTTATGGTGATCAGCATGGCAATTGCATTTACACTTGCTACAAGATGGTTCAGGAGGAGCCTCATTAAGTTTCCAAAACCCTTTGACAGGCTTA
CTGGATTCAATGCATTCTGGTATTCACACCACTTGTTCGTCATTGTCTACATCTTGCTTATCATCCATGGTGTATTCTTGTATCTCGTGCATAAATGGTACAAAAAGACG
ACATGGATGT
ATCTTTCTGTTCCAGTTTTACTATATGCAGGAGAAAGGGCCCTCAGGTTTTTTCGTTCTGGCTTCAATACTGTCAGGCTCCTCAAG
GTTGCAATTTATCCTGGAAATGTTCTCACATTGC
AAATGTCTAAGCCTCCCCAATTCCGATACAAGAGTGGACAGTATATGTTTGTCCAGTGCCCTGCTGTTTCTCCATTTGAGTG
GCATCCATTTTCAATCACCTCCGCGCCTGGTGATGACT
ACCTTAGTGTTCACATTCGGCAGCTAGGTGACTGGACTCAAGAACTAAGAAGGGTATTCTCTGAAGCCTGTGAATGTCCCGTGGCCGGTAAGAGTGGACTTCTCAGGGCTGATGAAACAA
CAAAGAAAAT
TTTGCCGAAGCTCTTAATAGATGGGCCTTATGGTGCACCAGCACAAGATTACCGCAAGTATGATGTGCTGCTGCTTGTTGGTTTGGGAATTGGAGCAACACCTTTCATCA
GCATTCTAAAAGATTTGCTTAATAACATTGTCAAAATGGAGGAGCAGGCA
GATTTGGTCTCGGATATCAGTAGGACATCAGACCTGAGCATTGGAAGTAATGATAATTCATCCTCTAACA
AAGTTTCAACGAAACGTAAAAAGGCTGTAAGGACCACCAATGCTTATTTCTATTGGGTAACAAGGGAGCAGGGCTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAGCTTG
ATCAAAGG
GGTGTGATTGAGATGCATAATTACTTGACCAGTGTGTATGAGGAAGGAGATGCCCGATCAACCCTCATTACCATGGTCCAAGCCCTAAACCATGCGAAAAACGGTGTGGACA
TTGTCTCTGGCACCAGG
GTGCGAACGCATTTTGCAAGGCCTAATTGGAAAAAGGTTCTTTCTAAATTATGTTCCAAGCACTGTAATGCAAGGATAGGCGTGTTTTACTGCGGGGCACCTG
TCTTGGCCAAGGAATTAAGCAGGCTCTGCTATGAATTCAATCAAAAAGGTTCCACAAAGTTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA