Entry information : PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Entry ID 6080
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2008-01-28 (Catherine )
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-04-22 (Catherine )
Peroxidase information: PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Name PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh09
start..stop
S start..stop
DgloRboh05 1466 0 4..926 5..927
VvRboh07 1461 0 10..926 8..917
DtriRboh04 1456 0 4..926 3..950
AgluRboh05 1444 0 3..926 27..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11398424..11399024 601 N° 2 11399119..11399278 160 N° 3 11399576..11399624 49 N° 4 11400096..11400209 114
N° 5 11400794..11401216 423 N° 6 11401459..11401842 384 N° 7 11401920..11402015 96 N° 8 11402112..11402227 116
N° 9 11402326..11402496 171 N° 10 11402587..11402746 160 N° 11 11402840..11403028 189 N° 12 11403146..11403274 129
N° 13 11403436..11403514 79 N° 14 11403667..11403776 110  
join(11398424..11399024,11399119..11399278,11399576..11399624,11400096..11400209 ,11400794..11401216,11401459..11401842,11401920..11402015,11402112..11402227,114 02326..11402496,11402587..11402746,11402840..11403028,11403146..11403274,1140343 6..11403514,11403667..11403776)


exon

Literature and cross-references PtRboh09(POPTR_0006s13950 / Potri.006G137300)
DNA ref. Phytozome 12:   Chr6 (11398424..11403776)
Cluster/Prediction ref. Genebank:   18100289
Omic ref. ePlant:   Potri.006G137300
Protein sequence: PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   926
PWM (Da):   %s   105212.12 Transmb domain:   %s   o364-386i499-521o548-570i727-744o
PI (pH):   %s   9.66
Sequence 967
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTSSFGRTSSRLSNYSRTFDLPDDDLDGSETASDCEIGGAMLPIFLNDLRRNNQDELVEVTLELEKDSIVVCSVNPNGRGMSTPSTPGGGAAAGILERSLSATSRIRRKFGWLRSRSSRTTWSENEERVISARDARKLKAKLDRSKLSAQRGLKGLRFINKTTGTTSESNELWKRVESRFKLLSKDGLLAREDFGECIGMVNSKEFAVCIFDALARRKRQRITKISKEELHDFWLQISDQSFDARLQIFFDMADSNEDGRIIREEVQELIMLSASANKLSKLKEQAEEYASLIMEELDPENLGYIELWQLETLLLQRDTYMNYSRPLSTASVSWSQNISSIKPRNVMHRLSFKLRNLILEKWQRAWILSLWVMIMVGLFVWKFLQYKNKAAFHVMGYCLASAKGAAETLKFNMALILLPVCRNTLTWLRSTRARSFVPFDENINFHKMVAGAIVIGVILHAGNHLLCDFPRLINSSPENFALIASDFNNKKPTYKELVTGIEGVTGISMVVLLTIAFTLATGRFRRNGVRLPAPFNKLTGFNAFWYSHHLTGVVYILLLVHGTFLFLAHKWYQKTTWMYISAPLLLYMVERNVRTRRSEHYSVKLLKVSVLPGNVLSLILSKPQGFKYKSGQYIFLQCPAISSFEWHPFSITSAPGDDYLSVHIRIVGDWTEELKRVFTEENDSPSVIGRAKFGQLGHMDQTRQPKLYVDGPYGAPAQDYRNYDVLLLVGLGIGATPFISILRDLLNNTRTADNQMDSNTENSRSDDSSNSYASSSMTPVSKKRTQRTTNAHFYWVTREPGSFEWFKGVMDEVAEMDHKGQIELHNYLTSVYEEGDARSTLITMVQALNHAKHGVDIVSGTRVRTHFARPNWKEVFNKIASKHPFGTVGVFYCGMPVLAKELKKLCQELSHKTTTRFEFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGCG
GTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGTA
GAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCGA
GAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTTA
TAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATAG
GTAAATAGTTACTCAATAATAATCACTGGTTAAAAATAAATAATTTTATGTTTGTTGTTGGGTTTCTGACATGGTGTGTGAGCTATTGTGTTAGGGATGGTGAATTCGAAGGAGTTTGCG
GTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCTGACCAGAGTTTTGACGCGCGCCTTCAA
ATTTTCTTTGACAT
GTGCGTCTCTCTCTCTCTCATTTTTTTCACCCTCGAATGTTTTGAAAATCATAGTAGCAATTGGGATTTGACGATCTTTAAGTTCTACGTACAAACTCAACGGTGG
TGTTTCAGACTGTAGCATAAATCTCAGGTGGTAAGCATGCATGACCACCGTCGTCTCGATCTGCCTATATTTTTCGGGCGTTTGATCAGTACTTCTCAGACAAGTTCCAGGGCTCTTTAA
TTAATCTGCTGATAGTCTGGTTTTAATTCCAATCGGAAAACGAGAAACCTGAAACTTCTGGTGCATTGCAGGGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGAG
GTAATAATATTTTCAGTAGTATAATATTATTCTCCCAAAAGATTCCTAAATAATATTACACTACTGACTGAGATGCACAATACCAACTATGATAGAGTTGCTATTCGAAGAAATAATTCA
ATTAGATTTATTATTTTCGGGTGAAAAACATTAATAATTGTTTATTCCTGAGTTGTTGTTTCGCACGCATTCACCGGTTTTAGAAAGTGGTATTATTTCTTAATTCTTTTAGCATTAAAA
TATATAGGTTTCTCACAAATTAAGCAAATTAATCGGAGACATGTTTTACAACTGTGTTAACTACCATCAATCAAATCAAAGTATTTGTCAAGAAGCATATTTACATGACAACACCCTACA
TTTCTTTTTTTTTAATTTATTATTATAAAGTAGTTAGTTATATGCACATCATGAGCAACCGATGCCAGATAATATTTTAACTGTGACATTATTACTTTCTTTTAATCCCAGCTTATAATG
CTCAGTGCTTCTGCAAATAAACTGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
GTAAATCACAAATTC
AACCTTCAAATGATGATCAAGCTGATTGTTTACCTCAGTTCCAGCTTTTTGAATAGGTTAATAGTCGGTTTATTTGTGTTTTTGATATTTTTTTGTTTTAAATTAATTTTTTTAACGTTC
TTATATTGTTTTGGTATGTTAATATAAAAATAATTTTTTAAAAAAATATTATTTTAATATAATTTCAAACAAAAAATAATTTAAAAAATAACTATTAATATAATATCAAATAAAATTAAT
AAATTATTTTTAATTTAGCCTACCTTACATTCAGCCCGAGGACTCCTCGGGCCTCGTCATGAAAACCACAAATCATGTAGTGGATGCCACAAATCACTGAATTTACTATATTTCTTTCTT
TTATTGGTTTCATGATTTATTATAAATTTATGATTCATGTACTTGTATTTAATATTCAGTAATAAAGTCACCGGAAGATTCATGACTAAAAAAAGTAACGGGAAGTTTTCTTGACTTTTT
CAGTCCTCCAACTTACAATTGGGCTTAGTCTTTTCATTTAAAAAAAAAAAAAAGATTTAAGAGAAAAAAGAGTTATTTCCCATTTTCAGTTATGGCAGTTAGAGACACTTCTTCTACAAA
GGGACACATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAATT
TAATTCTAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGCT
ATTGCTTGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTTG
TTCCTTTTGATGAAAATATTAATTTCCACAAG
GTAAGAAGGCTTACTATGCTAATTATATATAATTGACAAAGGATTTGGACAGGTTAATTAATAGATAAAAAGAAATCAAATTCATATA
CGATTTGCCTTTGCTTAAGGTTCTGTTCATAATTAATGATGGAGCAACAATCCGAGATTCTACAAGCCAAACAAATGAAAGAAGTGAATATTTAATAGAAACATGCTAAAAACATCGTCA
GTCCCTGACCCCCTCTTTTACCTTATTTTCCCAGATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACTCGTC
TCCTGAAAATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCATTGC
ATTCACTCTGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCTATAT
TCTGCTGCTCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
GTAAGAACTTTCGAAGCTTTTGTGACAAGATAATCAATAATTAGCAAGTAACATCTGTTATT
TTTCTGATTTTCCAGACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCAGAACATTATTCTGTAAAATTATTGAAGGTAATTAGT
CAAGTTCTTGGAGGCTTTAGCGCTGCTTTCTAGATGATCTCTTGTTTTTCTTGGCAAGAAGAGTCTAACATGACCTGATTCGGATAGGTGTCAGTGCTACCGGGAAATGTCCTCAGCTTA
ATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGCCCAGCAATTTCCTCCTTTGAATG
GTAGTGTTTCTGAAAATAACAACTCCTGTTAATTACA
ATAATTATTATTATTATGAAATATGATCATGTTTCAAAGAAATGAACCTAGTCCCTTTCAGGCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATCCGGA
TAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTCACCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
GTTATTTA
AACACTGAGCAACTCCACTGTATTAGACTTGCATTCAAACAATTTGTGAAAATATTGAGGCAAAATGCCTGCATTGCTGCAGACAACCAAAGCTGTATGTTGATGGTCCATATGGGGCTC
CAGCACAAGACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAATCAAA
TG
GTAAATGTCATTCCCTGAGATTTCATCTGTGCATATTATACTATTATAAAGTGAAGATTTACATCCAGCAATTGATTTTCTATGTTTTACTAGGATTCAAACACTGAAAACAGTCGGT
CAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGAGAGCCTGGATCTTTTGAAT
GGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GTAAGACAAAAACTTCCAACCCATGTTTCATTATCCATGTCTCAAATAAATTGCCACGGCTATCATTACAAAGTGA
TAGGTATTAACCTTCCCTCTTCTTATATAACAACAAAATAGGGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGGTCAACTTTGATCACCATGGTCC
AAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTATGTTCCCTGATAAATATAAAGTTTTAGGTTGTCAAAATTACTGTAGACAACAAGGTCAACCCGCCAA
TCAATAACTGGTGGGAGCTGGGAAATCAAATATTCAAAGCACCGCAGGGGTGAAGAAAACTTATTCATCATTTGGCTCTATTTTGTTGCAGGTGAGGACACACTTTGCAAGACCAAATTG
GAAAGAAGTGTTCAACAAAATTGCTTCAAAGCATCCGTTTGGCACAGTAG
GTAAGGAAAGCATACAAATTAATAAAACACCATTTTCATGTAATGACCAGATTACGGTTGAAAATACAAG
GCATCGATCTTCTGCAATCTTTTGGTAATAGACAAGTATTATAATTTTTTACTAAAAAACAGCTTGTTAAATTACAATGCAGGGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAAGGAG
CTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAGTTTCACAAGGAGTATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGCG
GTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGTA
GAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCGA
GAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTTA
TAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATAG
GGATGGTGAATTCGAAGGAGTTTGCGGTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCTG
ACCAGAGTTTTGACGCGCGCCTTCAAATTTTCTTTGACAT
GGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGAGCTTATAATGCTCAGTGCTTCTGCAAATAAAC
TGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
TTATGGCAGTTAGAGACACTTCTTCTACAAAGGGACA
CATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAATTTAATTC
TAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGCTATTGCT
TGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTTGTTCCTT
TTGATGAAAATATTAATTTCCACAAG
ATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACTCGTCTCCTGAAA
ATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCATTGCATTCACTC
TGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCTATATTCTGCTGC
TCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
ACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCAG
AACATTATTCTGTAAAATTATTGAAG
GTGTCAGTGCTACCGGGAAATGTCCTCAGCTTAATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGCC
CAGCAATTTCCTCCTTTGAATG
GCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATCCGGATAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTCA
CCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
ACAACCAAAGCTGTATGTTGATGGTCCATATGGGGCTCCAGCACAAG
ACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAATCAAATG
GATTCAA
ACACTGAAAACAGTCGGTCAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGAG
AGCCTGGATCTTTTGAATGGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGGT
CAACTTTGATCACCATGGTCCAAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTGAGGACACACTTTGCAAGACCAAATTGGAAAGAAGTGTTCAACAAAA
TTGCTTCAAAGCATCCGTTTGGCACAGTAG
GGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAAGGAGCTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAGT
TTCACAAGGAGTATTTCTGA

Retrieve as FASTA