Entry information : LeRboh02(Solyc03g117980.2.1/ whitefly-induced gp91-phox / Wfi1)
Entry ID 6099
Creation 2008-02-17 (Daniel Marino)
Last sequence changes 2010-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-10-23 (Christophe Dunand)
Peroxidase information: LeRboh02(Solyc03g117980.2.1/ whitefly-induced gp91-phox / Wfi1)
Name LeRboh02(Solyc03g117980.2.1/ whitefly-induced gp91-phox / Wfi1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Solanum
Organism Lycopersicon esculentum (Tomato)    [TaxId: 4081 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LeRboh02
start..stop
S start..stop
StRboh03 1876 0 1..938 1..938
NtRboh04_BelW3 1832 0 1..938 1..938
NbRboh02 1820 0 1..938 1..939
NtRboh04_bottom 1813 0 1..938 1..939
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..604 604 N° 2 744..906 163 N° 3 1011..1059 49 N° 4 1179..1292 114
N° 5 1374..1802 429 N° 6 1922..2305 384 N° 7 2398..2493 96 N° 8 2798..2913 116
N° 9 3092..3194 103 N° 10 3437..3510 74 N° 11 4141..4715 575 N° 12 4907..5016 110
join(1..604,744..906,1011..1059,1179..1292,1374..1802,1922..2305,2398..2493,2798 ..2913,3092..3194,3437..3510,4141..4715,4907..5016)


exon

Literature and cross-references LeRboh02(Solyc03g117980.2.1/ whitefly-induced gp91-phox / Wfi1)
Literature Puthoff DP, Walling LL A tomato homolog (Wfi1) of the mammalian gp91-phox is induced in response to insect feeding and pathogen attack. Submitted (MAY-1999) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   Q9LDD7
DNA ref. GenBank:   AF147783
mRNA ref. GenBank:   AF148534
Cluster/Prediction ref. UniGene:   Les.20537   Les.26
Protein sequence: LeRboh02(Solyc03g117980.2.1/ whitefly-induced gp91-phox / Wfi1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   938
PWM (Da):   %s   105010.59 Transmb domain:   %s   o367-389i509-531o551-573i733-750o
PI (pH):   %s   9.45
Sequence 979
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQNSENHHPHHHHHHSDTEVIGNDRASYSGPLSGPLNKRGGKKCARFNIPESTDIGTSAGAGAKSNDDAYVEITLDVREDSVAVHSVKTAGGADVEDPELALLAKGLEKKSTLGASLVRNASSRIRQVSQELKRLASLNKRPIPTGRFDRNKSAAAHALKGLKFISKTDGGAGWAAVEKRFDEITASTTGLLPRAKFGECIGMNKESKEFAGELYDALARRRNITTDSINKAQLKEFWDQVADQSFDTRLQTFFDMVDKDADGRITEEEVREIIGLSASANRLSTIQKQSDEYAAMIMEELDPNNLGYIMIENLEMLLLQAPNQTVQRGGESRNLSQMLSQKLKHTQEPNPLVRWYKSFKYFLLDSWQRVWVLLLWIGIMAGLFTWKYIQYKQKAAYGVMGPCVCLAKGAAETIKLNMAIILLPVCRNTITWLRNKTRLGSAVPFDDNLNFHKVIAVAVALGVAIHGLAHLTCDFPRLLNASEGAYEPMIYYFGEQPESYWWFVKGVEGVTGIIMVILMAIAFTLATPWFRRGRVSFPKPFHKLTGFNAFWYSHHLFIIVYTLLIVHGEKLYITKTWYKRTTWMYLTVPLALYAGERLLRAFRSSIKAVKILKVAVYPGNVLALHMSKPQGYKYKSGQYMFVNCAAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLKTVFSEVCQPPPNGKSGLLRADYLQGENNPNFPRVLIDGPYGAPAQDYKQYEVVLLVGLGIGATPMISIVKDIVNNMKAMDEEENSLENGHGMSNAAQNASPNMAQKRGKSGSASGRNSFNTRRAYFYWVTREQGSFDWFKGIMNEAAEMDHKGVIEMHNYCTSVYEEGDARSALITMLQSLHHAKNGVDIVSGTRVKSHFAKPNWRNVYKRIALNHPEAKVGVFYCGAPALTKELKQHALDFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns), 1 mRNA and 41 ESTs. Cultivar="Rutgers", "Kennebec" and "Shepody".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAAAATTCGGAAAATCATCACCCACACCATCACCATCATCACTCGGATACGGAGGTTATAGGGAATGATAGAGCGTCGTACAGTGGTCCTTTAAGCGGACCGCTGAACAAACGAGGAG
GAAAAAAGTGCGCGAGGTTTAATATACCGGAATCTACTGACATCGGAACTAGTGCAGGAGCCGGCGCCAAGTCCAATGACGATGCTTATGTGGAAATCACTCTCGATGTTCGTGAAGACT
CTGTGGCTGTCCACAGTGTGAAAACTGCCGGCGGTGCTGACGTGGAAGATCCGGAGTTGGCTTTATTGGCTAAAGGTTTGGAGAAGAAATCTACCTTGGGAGCTTCACTTGTACGAAATG
CTTCTTCGAGAATCCGGCAAGTGTCTCAAGAGCTCAAGCGATTGGCTTCCTTAAATAAGCGCCCAATTCCTACTGGAAGGTTCGACAGGAATAAATCAGCTGCTGCTCATGCTCTTAAAG
GTCTTAAGTTCATCAGCAAAACTGACGGCGGCGCTGGATGGGCCGCCGTCGAGAAGCGGTTCGATGAGATTACTGCTTCAACTACTGGCTTGCTTCCTCGGGCCAAATTTGGAGAATGCA
TAG
GTAAATTAAATGAATTATAGTCACAACAGACAATTATTTCGTGTTGTATACTTCATTTTAGTGTTACTTTTTCGTGTAGTTTTATTTTTCTTGAGCTTGTTAAAATGGAAAATGAAA
ATAAATTGTTTTTGAATGTTAGGTATGAATAAGGAGTCTAAGGAATTTGCTGGAGAGCTATATGATGCGCTTGCTCGAAGGAGAAACATCACAACTGATTCCATTAACAAAGCACAACTC
AAAGAGTTCTGGGACCAAGTTGCAGATCAAAGTTTTGATACTCGACTTCAGACCTTCTTTGACAT
GTAAGGGTTAATTATCAGTTACAGTTCAATATTTATCTCATAAATTAAGCATCTC
AGATTCAATCGTTCAGATCTAAATCGTGTGATGAATTTAATTAATACAGGGTTGATAAAGATGCAGATGGTAGAATCACAGAAGAAGAAGTCAGAGAGGTATTTCTGAATTCTGTTTTTT
AATTTTTTTATTGTACGTCAGAAACTCGGTATGGCATTGACAAAGTCGATCATATTTTATATTTTTTTTCTTCTATAATTTGTTTTGCGATTTGCAGATTATCGGCCTTAGTGCGTCTGC
CAACAGGCTGTCAACTATCCAGAAACAATCTGATGAATACGCGGCAATGATCATGGAAGAGTTGGATCCTAATAACCTGGGATACATTATG
GTAATTAAGAGGCATTAATAGTAAGCTTA
AATTTATAGAACTAAATTGAAAATTAACTGTTGATGCTATGATATTCAACAGATTGAGAACTTGGAAATGCTTTTACTGCAAGCACCAAATCAAACGGTGCAGAGAGGAGGCGAAAGCCG
GAACTTGAGTCAGATGCTAAGTCAGAAACTTAAGCACACACAAGAGCCAAATCCATTAGTGAGATGGTATAAGAGTTTTAAGTACTTTTTGCTGGATAGTTGGCAAAGAGTTTGGGTATT
GTTGTTGTGGATTGGAATCATGGCTGGTCTATTTACTTGGAAGTATATTCAGTATAAACAAAAAGCTGCATATGGTGTTATGGGTCCCTGTGTGTGTCTTGCTAAGGGTGCTGCTGAGAC
AATCAAGCTCAACATGGCTATCATTTTACTCCCAGTTTGCAGAAACACAATTACCTGGCTTCGTAACAAGACCAGATTAGGTTCTGCAGTTCCTTTCGATGATAATCTCAATTTTCACAA
A
GTAAGTTGATTAATTGTGCACAAGTCTAATGTCCAAATGATTATAGTTTTATCTATAAGACGTTTGAGTAGTCGATGGCTCATTACAGGAAACTAATTGGTTCGTTTTCCTCTGTTTAG

GTGATAGCAGTCGCGGTTGCACTTGGGGTTGCAATACACGGACTAGCTCATTTAACGTGTGATTTTCCTCGGCTTCTGAATGCTAGTGAAGGAGCATATGAACCAATGATATACTATTTT
GGAGAACAGCCCGAAAGCTATTGGTGGTTTGTTAAGGGAGTTGAAGGGGTAACTGGAATTATAATGGTGATCCTAATGGCAATAGCTTTTACCCTAGCAACCCCATGGTTTAGAAGGGGC
AGAGTCAGTTTCCCTAAACCATTTCACAAGCTCACTGGATTCAATGCCTTTTGGTACTCACACCATCTGTTTATCATTGTCTACACTCTACTTATTGTCCATGGAGAAAAACTATACATA
ACCAAAACTTGGTACAAGAGAACG
GTTAGTAAAATGTTCAAAACCTTTTATTTTCATTTAAGTTTCTAAGTTGATGAATGTCGCTAAAATTTAAATTGATTATTCGTAATTGGCAGACAT
GGATGTACCTTACTGTCCCACTAGCACTCTATGCTGGTGAAAGGTTGCTTAGAGCATTCAGGTCAAGCATCAAAGCCGTTAAGATTTTGAAG
GTAAATCCAATCCGACAAAAGTGTCGTG
CTCTTAATAATTCAAGATAAATTTACATTTTAGTCCCTCAGTAATTAACAAATTTCAGTTTTAGTCCAAATGATACACAATTAAATTATTCAGCTTCCCATATGTTTTATATGCTTAATT
TATTTTGTTACTTCACAGTTGGGATGATAAAATAAATTAAATAATGTAATGTATTTTCTATATAAAGGGATAAAAAATGCAATTATCTTATATTCCATATAATCGTGACTTCATAAAAAT
GAAAATAGACAAACTAATTAATTGTGGAATTTGTAGGTGGCTGTGTATCCAGGAAATGTGTTGGCCCTTCACATGTCAAAACCACAAGGCTACAAATACAAAAGTGGGCAATACATGTTT
GTCAACTGTGCTGCGGTTTCACCATTTGAATG
GTAGGTGAAACTTTTCTTATTTAATTATTAAAATAATGGAATCAACCCATCCATTTTTTATTATATATTTCTCATGTCATAATAAACG
TGACCAAGTCATGAATTTTTGGTATCCTTTAATTACCTCGTCTCTGCAGTATTTGCTGACTTATGGATAAACATTAATATAAAATTTCAGGCATCCATTTTCCATTACTTCGGCCCCAGG
AGATGACTATCTCAGTGTCCATATTAGAACTCTTGGTGATTGGACCAGACAACTTAAAACTGTTTTCTCCGAG
GTAATTACTAATTAGACCATTTAAATATAATTATATATTACTTAAAT
CCTTAAACCAAAATATCTAGTTAATTAAAATAGTGGAGGCATGATTGTTCCACTTTGGATGACAGCTTTAAAAGCCGTCTCTTATATTTTTTCTTTATGTCGTTTTTTCCCAAAAAGTAA
ATGTTAATTCCACTATGTTAGTTTTAATTATTGATCTTCCTGAATTAATTATTAGTAATTTTTGGTCTTTGTTAGGTTTGCCAGCCACCACCTAATGGGAAAAGTGGACTCCTTAGAGCT
GACTACTTGCAAGGAGAGAATAATCCAAA
GTAAGTCCTTTTCCATTCTATAATCATCTTTTTAAGCACACTGAAATGCAGAATTAAATTAAAAAAACTCTCACCTTAATATCCGGGGATA
TTATTCTTATAATACAAACTTTTTGATAATTTAATACTGCAAATGTAATTAGTTTAGATCTTAAAGTGATCGTGATTGGTCTGGTCTGGTACCTATAACAAACCTGTAGTCAGTTTTATC
CTAAAGAAATCTGTACACGTTTTGAATGGACCACTTCTTAAAGTACTACAGGATTATTATTTTGTGAAATTACCGGGATAGGGACAAGGAGGGATAGAACAGAACTCAATTATTGCTTGA
TATTTCTAAGGACACAAAAAAGAACCATTTGCTTGCAAGATATTTTTCTAGTTAAGAATTAATTTTACATATATCTACAATTTTTAATATGCTATAGAAGGTTACTTGTTTAATTTCTCA
AATTACAAAATTTTATTATTATTATACATAATTACTTCTAATTGCCTTCTAGATAATTCAAAAAATAGTGCAATAACATTTTTAAGAGTCCAAATAACATCATATAAGGTGGAAGTTAAA
CTCTACCATGAAAATTTAATTAAATGGCATAGCTAATGGTAATCATATGTAATTGGCAGTTTCCCAAGAGTGTTAATTGATGGACCATACGGAGCACCAGCACAAGACTACAAGCAGTAT
GAGGTGGTTTTATTGGTGGGTCTTGGAATTGGAGCCACACCAATGATCAGTATCGTTAAAGACATTGTCAACAACATGAAGGCCATGGACGAAGAAGAAAATTCCTTGGAAAATGGGCAC
GGGATGTCCAATGCAGCACAAAATGCTAGCCCAAATATGGCACAGAAGAGGGGTAAATCAGGTTCAGCAAGTGGAAGAAATAGCTTCAATACAAGGAGGGCATATTTCTATTGGGTCACA
AGGGAACAAGGTTCATTTGACTGGTTCAAAGGTATAATGAATGAAGCTGCTGAAATGGATCATAAGGGAGTAATTGAAATGCACAATTATTGTACAAGTGTTTATGAAGAAGGTGATGCT
CGTTCTGCTCTTATTACTATGCTTCAGTCACTTCATCATGCCAAAAATGGTGTAGACATTGTTTCTGGCACGAGAGTTAAGTCACACTTTGCTAAGCCTAATTGGAGAAACGTCTACAAA
CGCATTGCTCTCAACCACCCAGAGGCTAAAGTTG
GTGAGTACTATTAATCAATCTTCTTTCTTTTGACTTTGGTGTCTTTATGTCCTTGTGAGAGTTGAAAAAAGCATGTTCAATTGATA
AGTTTTTCTTTGTGAAAGCAATTGGCACTAGTGTCATTTTCAAATCCATTTCATGACATATATTGTCGATGGCTAACTCGTTTTCCCTTTTTTGACAATTTGCAGGAGTGTTCTACTGTG
GGGCACCGGCACTAACGAAAGAGCTAAAACAACACGCATTGGATTTTTCACACAAGACATCCACCAAGTTTGATTTCCATAAAGAAAATTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAAAATTCGGAAAATCATCACCCACACCATCACCATCATCACTCGGATACGGAGGTTATAGGGAATGATAGAGCGTCGTACAGTGGTCCTTTAAGCGGACCGCTGAACAAACGAGGAG
GAAAAAAGTGCGCGAGGTTTAATATACCGGAATCTACTGACATCGGAACTAGTGCAGGAGCCGGCGCCAAGTCCAATGACGATGCTTATGTGGAAATCACTCTCGATGTTCGTGAAGACT
CTGTGGCTGTCCACAGTGTGAAAACTGCCGGCGGTGCTGACGTGGAAGATCCGGAGTTGGCTTTATTGGCTAAAGGTTTGGAGAAGAAATCTACCTTGGGAGCTTCACTTGTACGAAATG
CTTCTTCGAGAATCCGGCAAGTGTCTCAAGAGCTCAAGCGATTGGCTTCCTTAAATAAGCGCCCAATTCCTACTGGAAGGTTCGACAGGAATAAATCAGCTGCTGCTCATGCTCTTAAAG
GTCTTAAGTTCATCAGCAAAACTGACGGCGGCGCTGGATGGGCCGCCGTCGAGAAGCGGTTCGATGAGATTACTGCTTCAACTACTGGCTTGCTTCCTCGGGCCAAATTTGGAGAATGCA
TAG
GTATGAATAAGGAGTCTAAGGAATTTGCTGGAGAGCTATATGATGCGCTTGCTCGAAGGAGAAACATCACAACTGATTCCATTAACAAAGCACAACTCAAAGAGTTCTGGGACCAAG
TTGCAGATCAAAGTTTTGATACTCGACTTCAGACCTTCTTTGACAT
GGTTGATAAAGATGCAGATGGTAGAATCACAGAAGAAGAAGTCAGAGAGATTATCGGCCTTAGTGCGTCTGCCA
ACAGGCTGTCAACTATCCAGAAACAATCTGATGAATACGCGGCAATGATCATGGAAGAGTTGGATCCTAATAACCTGGGATACATTATG
ATTGAGAACTTGGAAATGCTTTTACTGCAAG
CACCAAATCAAACGGTGCAGAGAGGAGGCGAAAGCCGGAACTTGAGTCAGATGCTAAGTCAGAAACTTAAGCACACACAAGAGCCAAATCCATTAGTGAGATGGTATAAGAGTTTTAAGT
ACTTTTTGCTGGATAGTTGGCAAAGAGTTTGGGTATTGTTGTTGTGGATTGGAATCATGGCTGGTCTATTTACTTGGAAGTATATTCAGTATAAACAAAAAGCTGCATATGGTGTTATGG
GTCCCTGTGTGTGTCTTGCTAAGGGTGCTGCTGAGACAATCAAGCTCAACATGGCTATCATTTTACTCCCAGTTTGCAGAAACACAATTACCTGGCTTCGTAACAAGACCAGATTAGGTT
CTGCAGTTCCTTTCGATGATAATCTCAATTTTCACAAA
GTGATAGCAGTCGCGGTTGCACTTGGGGTTGCAATACACGGACTAGCTCATTTAACGTGTGATTTTCCTCGGCTTCTGAATG
CTAGTGAAGGAGCATATGAACCAATGATATACTATTTTGGAGAACAGCCCGAAAGCTATTGGTGGTTTGTTAAGGGAGTTGAAGGGGTAACTGGAATTATAATGGTGATCCTAATGGCAA
TAGCTTTTACCCTAGCAACCCCATGGTTTAGAAGGGGCAGAGTCAGTTTCCCTAAACCATTTCACAAGCTCACTGGATTCAATGCCTTTTGGTACTCACACCATCTGTTTATCATTGTCT
ACACTCTACTTATTGTCCATGGAGAAAAACTATACATAACCAAAACTTGGTACAAGAGAACG
ACATGGATGTACCTTACTGTCCCACTAGCACTCTATGCTGGTGAAAGGTTGCTTAGAG
CATTCAGGTCAAGCATCAAAGCCGTTAAGATTTTGAAG
GTGGCTGTGTATCCAGGAAATGTGTTGGCCCTTCACATGTCAAAACCACAAGGCTACAAATACAAAAGTGGGCAATACATGT
TTGTCAACTGTGCTGCGGTTTCACCATTTGAATG
GCATCCATTTTCCATTACTTCGGCCCCAGGAGATGACTATCTCAGTGTCCATATTAGAACTCTTGGTGATTGGACCAGACAACTTA
AAACTGTTTTCTCCGAG
GTTTGCCAGCCACCACCTAATGGGAAAAGTGGACTCCTTAGAGCTGACTACTTGCAAGGAGAGAATAATCCAAATTTCCCAAGAGTGTTAATTGATGGACCAT
ACGGAGCACCAGCACAAGACTACAAGCAGTATGAGGTGGTTTTATTGGTGGGTCTTGGAATTGGAGCCACACCAATGATCAGTATCGTTAAAGACATTGTCAACAACATGAAGGCCATGG
ACGAAGAAGAAAATTCCTTGGAAAATGGGCACGGGATGTCCAATGCAGCACAAAATGCTAGCCCAAATATGGCACAGAAGAGGGGTAAATCAGGTTCAGCAAGTGGAAGAAATAGCTTCA
ATACAAGGAGGGCATATTTCTATTGGGTCACAAGGGAACAAGGTTCATTTGACTGGTTCAAAGGTATAATGAATGAAGCTGCTGAAATGGATCATAAGGGAGTAATTGAAATGCACAATT
ATTGTACAAGTGTTTATGAAGAAGGTGATGCTCGTTCTGCTCTTATTACTATGCTTCAGTCACTTCATCATGCCAAAAATGGTGTAGACATTGTTTCTGGCACGAGAGTTAAGTCACACT
TTGCTAAGCCTAATTGGAGAAACGTCTACAAACGCATTGCTCTCAACCACCCAGAGGCTAAAGTTG
GAGTGTTCTACTGTGGGGCACCGGCACTAACGAAAGAGCTAAAACAACACGCAT
TGGATTTTTCACACAAGACATCCACCAAGTTTGATTTCCATAAAGAAAATTTTTGA

Retrieve as FASTA