Entry information : NcKat04
Entry ID 6123
Creation 2008-03-25 (Marcel Zamocky)
Last sequence changes 2008-03-25 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcKat04
Name NcKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcKat04
start..stop
S start..stop
SAcoKat01 776 0 3..501 4..500
CnKat04_grubiiH99 634 0 6..489 5..496
CnKat04_B-3501A 630 0 6..489 5..496
CnKat04_JEC21 630 0 6..489 5..496
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5893422..5893430 9 N° 2 5891820..5893361 1542  
complement(join(5891820..5893361,5893422..5893430))


exon

Literature and cross-references NcKat04
Literature Schliebs W., W�rtz, C., Kunau, W.-H., Veenhuis, M., and Rottensteiner, H.-P. (2006) "A eukaryote without catalase-containing microbodies: Neurospora crassa exhibits a unique cellular distribution of its four catalases" Eukaryotic Cell 5: 1490-1502
Protein ref. GenBank:   XP_961873.1 UniProtKB:   Q7S8G4
DNA ref. JGI genome:   supercont10.4 (5893430..5891820)
mRNA ref. GenBank:   XM_956780
Protein sequence: NcKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   516
PWM (Da):   %s   58095.87  
PI (pH):   %s   6.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSNDAPVYTLAEGRPVQDPSAATVLMGSKPRGGALSLLADTQLIETLAHFPRERIPERVVHAKAAGAWGEFECTEDVSDFTSVDFLNKVGKKTKVLARISTVAGEKGSADTVRDIRGFAVKFFTEEGNWDFVGNDLPVFFIRDPVKFPSLNRSHKRHPQTNVPDSTMFWDFHNNNQEGVHCLMQLFGGRGIPASLRNVNAFGNHTYKFGKPEDGTFKYVKIHLKPDAGIKNLESDEALRLAGEEPDFHIKDMYNAIERGDYPTWTMYFQIMDPKDAETYRYNIFDITQTWSHRDYPLRPIGKLRLNKNPENHFQDIEQAAFSPSTMVPGIGPSADPMLQARMFSYPDAARYRVGPNYQQLPCNRALHVYSPYQRDGPMRVDGNYGGDPDYVRSSFRPMRFGPPDVAHDEWAGKVALFTSEVTDLDFEQPRDLWKIFKETGEDKRFAKNVAAHVGKALPEVQKKTIEMFSKVDQEVGEAIQRELDELEKKGGAGIEHDKAPVKGKGMRCKDSKDDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 1 intron). Strain="OR74A", "ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAGTAAGTTTGTCTTTTGTGCCCTCCACAAGATCCGCCCATACTGACCTCTACTTCTTCTAGAACGACGCACCGGTTTACACACTTGCCGAGGGACGCCCCGTCCAGGACCCT
TCGGCTGCCACGGTCCTGATGGGCTCGAAGCCTCGTGGCGGAGCCCTCTCTCTCCTCGCAGACACCCAGCTGATCGAAACCCTCGCCCACTTCCCCCGAGAACGCATCCCCGAACGTGTC
GTCCACGCCAAGGCAGCCGGTGCCTGGGGAGAGTTTGAGTGCACGGAAGATGTCTCGGACTTTACATCTGTTGACTTTCTCAACAAGGTCGGAAAGAAGACCAAGGTCCTGGCCCGTATT
TCCACGGTGGCGGGTGAGAAGGGCTCTGCCGATACGGTTCGTGATATCCGCGGTTTCGCCGTCAAGTTCTTCACCGAGGAAGGCAACTGGGACTTTGTCGGCAATGACCTGCCCGTCTTC
TTCATCCGCGATCCCGTCAAGTTCCCCAGTCTCAACCGCTCCCACAAGCGTCACCCCCAGACCAACGTGCCCGACTCGACCATGTTCTGGGACTTCCACAACAACAACCAAGAAGGCGTC
CACTGCTTGATGCAGCTCTTTGGCGGCCGTGGCATCCCCGCCTCTCTCCGCAATGTCAACGCCTTTGGCAACCACACCTACAAGTTCGGCAAGCCCGAGGACGGCACGTTCAAGTACGTC
AAGATCCACTTGAAGCCCGACGCCGGCATCAAGAACCTCGAGTCCGACGAAGCCCTCCGCCTGGCTGGCGAGGAACCCGATTTCCACATCAAGGACATGTACAATGCCATCGAGCGCGGC
GACTACCCCACCTGGACCATGTACTTCCAGATCATGGACCCCAAGGACGCCGAAACCTACCGGTACAACATCTTTGACATTACGCAGACCTGGTCGCATCGGGACTATCCCCTGCGTCCC
ATCGGTAAACTCAGGCTTAACAAGAACCCGGAAAACCACTTCCAGGATATCGAGCAAGCCGCCTTCTCCCCCTCCACCATGGTCCCTGGCATCGGCCCTAGCGCCGACCCCATGCTCCAG
GCTAGAATGTTCTCCTACCCTGATGCCGCCCGCTACCGTGTCGGACCCAACTACCAACAACTCCCTTGCAACCGCGCCTTGCACGTCTATTCTCCGTACCAGCGTGACGGTCCAATGCGC
GTAGACGGCAACTATGGTGGCGACCCGGATTATGTGCGGTCTTCCTTCCGTCCCATGCGTTTCGGTCCCCCTGACGTCGCTCACGACGAGTGGGCCGGTAAGGTTGCCTTGTTCACCTCG
GAAGTGACCGACCTCGATTTCGAGCAGCCGAGGGATCTGTGGAAGATCTTTAAGGAGACCGGAGAAGACAAGCGGTTTGCCAAGAACGTGGCGGCGCATGTGGGCAAGGCGTTGCCGGAG
GTGCAAAAGAAGACAATCGAGATGTTTAGTAAGGTTGATCAGGAGGTGGGCGAGGCTATCCAAAGAGAGTTGGATGAGCTTGAGAAGAAGGGCGGTGCGGGCATTGAGCATGACAAGGCG
CCGGTGAAGGGGAAGGGCATGAGGTGTAAGGATTCGAAGGATGATGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAAACGACGCACCGGTTTACACACTTGCCGAGGGACGCCCCGTCCAGGACCCTTCGGCTGCCACGGTCCTGATGGGCTCGAAGCCTCGTGGCGGAGCCCTCTCTCTCCTCGCA
GACACCCAGCTGATCGAAACCCTCGCCCACTTCCCCCGAGAACGCATCCCCGAACGTGTCGTCCACGCCAAGGCAGCCGGTGCCTGGGGAGAGTTTGAGTGCACGGAAGATGTCTCGGAC
TTTACATCTGTTGACTTTCTCAACAAGGTCGGAAAGAAGACCAAGGTCCTGGCCCGTATTTCCACGGTGGCGGGTGAGAAGGGCTCTGCCGATACGGTTCGTGATATCCGCGGTTTCGCC
GTCAAGTTCTTCACCGAGGAAGGCAACTGGGACTTTGTCGGCAATGACCTGCCCGTCTTCTTCATCCGCGATCCCGTCAAGTTCCCCAGTCTCAACCGCTCCCACAAGCGTCACCCCCAG
ACCAACGTGCCCGACTCGACCATGTTCTGGGACTTCCACAACAACAACCAAGAAGGCGTCCACTGCTTGATGCAGCTCTTTGGCGGCCGTGGCATCCCCGCCTCTCTCCGCAATGTCAAC
GCCTTTGGCAACCACACCTACAAGTTCGGCAAGCCCGAGGACGGCACGTTCAAGTACGTCAAGATCCACTTGAAGCCCGACGCCGGCATCAAGAACCTCGAGTCCGACGAAGCCCTCCGC
CTGGCTGGCGAGGAACCCGATTTCCACATCAAGGACATGTACAATGCCATCGAGCGCGGCGACTACCCCACCTGGACCATGTACTTCCAGATCATGGACCCCAAGGACGCCGAAACCTAC
CGGTACAACATCTTTGACATTACGCAGACCTGGTCGCATCGGGACTATCCCCTGCGTCCCATCGGTAAACTCAGGCTTAACAAGAACCCGGAAAACCACTTCCAGGATATCGAGCAAGCC
GCCTTCTCCCCCTCCACCATGGTCCCTGGCATCGGCCCTAGCGCCGACCCCATGCTCCAGGCTAGAATGTTCTCCTACCCTGATGCCGCCCGCTACCGTGTCGGACCCAACTACCAACAA
CTCCCTTGCAACCGCGCCTTGCACGTCTATTCTCCGTACCAGCGTGACGGTCCAATGCGCGTAGACGGCAACTATGGTGGCGACCCGGATTATGTGCGGTCTTCCTTCCGTCCCATGCGT
TTCGGTCCCCCTGACGTCGCTCACGACGAGTGGGCCGGTAAGGTTGCCTTGTTCACCTCGGAAGTGACCGACCTCGATTTCGAGCAGCCGAGGGATCTGTGGAAGATCTTTAAGGAGACC
GGAGAAGACAAGCGGTTTGCCAAGAACGTGGCGGCGCATGTGGGCAAGGCGTTGCCGGAGGTGCAAAAGAAGACAATCGAGATGTTTAGTAAGGTTGATCAGGAGGTGGGCGAGGCTATC
CAAAGAGAGTTGGATGAGCTTGAGAAGAAGGGCGGTGCGGGCATTGAGCATGACAAGGCGCCGGTGAAGGGGAAGGGCATGAGGTGTAAGGATTCGAAGGATGATGAGTGA

Retrieve as FASTA