Entry information : SmPrx56-1_5 (SmPrx56a_5)
Entry ID 6206
Creation 2008-08-07 (Christophe Dunand)
Last sequence changes 2011-01-26 (Toky Ramarohetra)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2011-03-03 (Nizar Fawal)
Peroxidase information: SmPrx56-1_5 (SmPrx56a_5)
Name (synonym) SmPrx56-1_5 (SmPrx56a_5)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx56-1_5
start..stop
S start..stop
SmPrx56-2_33 692 0 1..336 1..336
GbPrx04 390 1e-136 13..336 7..329
SmPrx106-1_173 386 7e-135 40..333 58..352
SmPrx106-2_43 385 3e-134 40..333 62..356
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3630447..3630689 243 N° 2 3630154..3630345 192 N° 3 3629928..3630093 166 N° 4 3629444..3629853 410
complement(join(3629444..3629853,3629928..3630093,3630154..3630345,3630447..3630 689))


exon

Literature and cross-references SmPrx56-1_5 (SmPrx56a_5)
Literature JGI
DNA ref. JGI genome:   Scaffold_5 (3630689..3629444)
Protein sequence: SmPrx56-1_5 (SmPrx56a_5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (311)
PWM (Da):   %s   36807.53 (34252.1)  
PI (pH):   %s   6.73 (7.63) Peptide Signal:   %s   cut: 30 range:26-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSPLGDANTTLILLALVFLSSIVADVSCSSDDPSLSAFFYDYTCPQLQDIVRSDVEKAFKREARIAASLLRLHFHDCFINGCDASVLLDDTKTFKGEKSALPNANSLRGFELIDAIKARVEIQCEGVVSCADILTLAARDSVALTGGPSWEVLLGRRDSLTANRTAANVLIPPPIADVPKLVSMFATMGLTEVDMVTLSGAHSIGQARCSTFRQRLFDDRGSGSPDPTMQKQFLGSLQEICPRQGNGNAVAPLDFVTPMRFDNNYYLNLQYGKGIFASDQVLFSGRGITENYVRYYSYDQDAFFQSFVRSMIKMGNITPLTGKRGQIRKNCRRPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCTCTGGGAGATGCGAACACCACCTTGATCTTGCTCGCGCTCGTGTTCTTGAGCTCCATTGTCGCGGACGTGAGTTGTAGCAGCGATGATCCATCGCTGAGCGCTTTCTTC
TACGATTATACGTGCCCCCAGCTCCAGGACATCGTTCGATCGGACGTGGAGAAGGCTTTCAAGCGCGAGGCACGGATCGCGGCGTCGCTTCTCCGCCTCCATTTCCACGACTGCTTCATC
AAT
GTGAGTAAGCAATCCAAAACTCTGAAAGCTTTAAGTAGTACCTTAGTGTTCTCCCAAGTTTCTCGGGCGAAAGAGAAGAAAAAAACGATTTTTTTCCGCAGGGATGCGATGCCTCGG
TGCTGCTGGACGACACCAAGACCTTCAAAGGCGAGAAATCTGCGCTGCCCAACGCGAACTCTCTCCGTGGATTCGAACTCATCGACGCGATCAAGGCCAGAGTGGAGATCCAGTGCGAAG
GAGTCGTCTCCTGTGCTGATATCTTGACGCTCGCTGCTCGAGACTCAGTCGCACTG
GTACGTAGTACCAAGAAAATCCCTCCTTTCTGATCGATCGATCGGTCCAACTCTTATCAGACCG
GAGGACCATCGTGGGAAGTGCTGCTCGGGCGGAGGGACAGCCTCACTGCCAACAGAACCGCGGCCAACGTTCTCATCCCACCCCCTATAGCCGACGTTCCAAAGCTCGTCTCAATGTTCG
CCACAATGGGGCTCACCGAGGTAGACATGGTAACACTTTCCG
GTACGTAATAAAATCCCCACCGTCCATCGCCGCGCCCATTCTGACCCGGAATGTCCACTGTTCTTGGCGCCAAGGCGC
CCACAGCATCGGCCAGGCGCGATGTTCCACCTTCCGCCAGCGATTATTCGACGATCGCGGCAGCGGCAGCCCCGATCCGACCATGCAGAAGCAGTTCCTGGGCTCGCTGCAAGAGATTTG
CCCCCGGCAGGGCAACGGCAACGCGGTGGCGCCGCTGGATTTCGTGACGCCCATGCGATTTGACAACAATTACTACCTCAATCTCCAGTATGGCAAGGGGATCTTCGCGTCGGACCAGGT
GCTCTTCAGCGGGCGCGGGATCACGGAGAACTACGTGCGCTACTACAGCTACGATCAAGACGCATTCTTCCAGAGCTTCGTGCGCTCCATGATCAAAATGGGCAACATCACGCCGCTAAC
AGGGAAGAGAGGCCAGATTCGAAAGAACTGCCGAAGACCTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCTCTGGGAGATGCGAACACCACCTTGATCTTGCTCGCGCTCGTGTTCTTGAGCTCCATTGTCGCGGACGTGAGTTGTAGCAGCGATGATCCATCGCTGAGCGCTTTCTTC
TACGATTATACGTGCCCCCAGCTCCAGGACATCGTTCGATCGGACGTGGAGAAGGCTTTCAAGCGCGAGGCACGGATCGCGGCGTCGCTTCTCCGCCTCCATTTCCACGACTGCTTCATC
AAT
GGATGCGATGCCTCGGTGCTGCTGGACGACACCAAGACCTTCAAAGGCGAGAAATCTGCGCTGCCCAACGCGAACTCTCTCCGTGGATTCGAACTCATCGACGCGATCAAGGCCAGA
GTGGAGATCCAGTGCGAAGGAGTCGTCTCCTGTGCTGATATCTTGACGCTCGCTGCTCGAGACTCAGTCGCACTG
ACCGGAGGACCATCGTGGGAAGTGCTGCTCGGGCGGAGGGACAGC
CTCACTGCCAACAGAACCGCGGCCAACGTTCTCATCCCACCCCCTATAGCCGACGTTCCAAAGCTCGTCTCAATGTTCGCCACAATGGGGCTCACCGAGGTAGACATGGTAACACTTTCC
G
GCGCCCACAGCATCGGCCAGGCGCGATGTTCCACCTTCCGCCAGCGATTATTCGACGATCGCGGCAGCGGCAGCCCCGATCCGACCATGCAGAAGCAGTTCCTGGGCTCGCTGCAAGAG
ATTTGCCCCCGGCAGGGCAACGGCAACGCGGTGGCGCCGCTGGATTTCGTGACGCCCATGCGATTTGACAACAATTACTACCTCAATCTCCAGTATGGCAAGGGGATCTTCGCGTCGGAC
CAGGTGCTCTTCAGCGGGCGCGGGATCACGGAGAACTACGTGCGCTACTACAGCTACGATCAAGACGCATTCTTCCAGAGCTTCGTGCGCTCCATGATCAAAATGGGCAACATCACGCCG
CTAACAGGGAAGAGAGGCCAGATTCGAAAGAACTGCCGAAGACCTAATTAG

Retrieve as FASTA