Entry information : SmKat02-2_1 (SmKat02b_1)
Entry ID 6215
Creation 2008-07-07 (Christophe Dunand)
Last sequence changes 2011-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-01 (Christophe Dunand)
Peroxidase information: SmKat02-2_1 (SmKat02b_1)
Name (synonym) SmKat02-2_1 (SmKat02b_1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmKat02-2_1
start..stop
S start..stop
SmKat02-1_5 1036 0 1..492 1..492
SmKat01-2_44 910 0 1..492 1..492
AcvKat02 897 0 1..492 1..492
SmKat01-1_2 895 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5716030..5716044 15 N° 2 5716117..5716213 97 N° 3 5716296..5716573 278 N° 4 5716653..5717429 777
N° 5 5717543..5717632 90 N° 6 5717701..5717768 68 N° 7 5717950..5718043 94 N° 8 5718138..5718197 60
join(5716030..5716044,5716117..5716213,5716296..5716573,5716653..5717429,5717543 ..5717632,5717701..5717768,5717950..5718043,5718138..5718197)


exon

Literature and cross-references SmKat02-2_1 (SmKat02b_1)
Literature JGI
DNA ref. Phytozome 12:   scaffold_1 (5716030..5718197)
mRNA ref. JGI transcript:   140901
EST ref. GenBank:   FE431243 [5' end]
Protein sequence: SmKat02-2_1 (SmKat02b_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56647.92  
PI (pH):   %s   7.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHTPSSAFNSSFFTTNSGTPVWNNNSSLTVGSRGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGYFEVTHDISNLTCADFLRAPGVQTPLIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNIPVFFVRDGIKFPDMIHALKPNPKTHVQEPWRIMDHFSHHPESCHMFTFLFDDHGIPLNYRHMEGFGVHTFTLVNRAGKCTYVKFHWKPTCGLKYLSKQEAVVVGGSNHSHATKDLYDSIAAGNYPEWKLFIQTMNPSNEEMFDFDPLDVTKTWPEEMFPLQPVGRMVLNKNIDNFFAENEQLAFCPALIVPGVYYTDDKMLQTRIFSYADTQRHRLGPNYLMLPANAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRFDAVRHAEQVPIPSRPVSGRREKVMLEKENNFAQPGVRYRSWPADRQERFIENWVDALSDSRVTHEIRSVWISYWSCDKSLGQRIAAQLQSKSNM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns + 2 introns in 3'UTR) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTATTAGTTCTCCTTTTTTTTTCTTTTTTTTTCCCCCCACGTTTAGTGCTCTAATCTTCTTCGTCTTTCCAGCACACTCCATCAAGCGCTTTCAATTCTTCTTTT
TTCACCACAAACTCTGGCACTCCCGTCTGGAACAACAATTCCTCTTTGACAGTTGGGTCACGAG
GTACGTTATGATAGTGTTCTTTCTTTCTTGTAAGCGTTTAATTTTTTTTTTCTCAA
CGATCTCTCACATGGTGTTTTATCAGGGCCTATTCTGCTGGAAGATTATCACTTGATCGAGAAGCTTGCTCAGTTTGACAGGGAACGCATTCCCGAGCGCGTCGTCCATGCGCGTGGAGC
AAGTGCAAAGGGTTACTTTGAAGTCACCCACGACATCTCAAACCTCACCTGCGCGGATTTCCTGCGTGCACCTGGAGTCCAGACACCGCTGATTGTGAGGTTCTCCACCGTCATTCACGA
ACGTGGAAGCCCCGAGACACTCCGTGATCCCAGAGGCTTTGCCGTCAAATTCTACACGCGGGAG
GTGAGTAAACTATCTGGTGATGTTGCTAAGTTGGACACGAAATTCCATCTTTGACT
TTTTTCGCTTTGTTTGCGAGCAGGGAAACTTCGATCTGGTTGGAAACAACATTCCCGTGTTCTTCGTACGTGATGGCATCAAGTTCCCTGACATGATCCACGCTCTCAAGCCAAACCCAA
AGACGCATGTTCAAGAGCCTTGGCGCATTATGGACCACTTCTCGCATCATCCGGAGAGCTGTCACATGTTTACTTTTCTCTTCGACGACCACGGAATTCCTCTCAATTACCGTCACATGG
AAGGCTTCGGGGTACACACGTTCACTCTGGTCAATCGCGCCGGCAAGTGTACGTATGTCAAGTTCCACTGGAAGCCAACTTGCGGACTAAAGTATCTGAGCAAGCAAGAGGCTGTGGTCG
TCGGCGGCTCTAATCACAGCCATGCAACCAAGGATCTCTACGACTCCATCGCGGCCGGAAACTATCCAGAGTGGAAGCTGTTCATTCAGACTATGAACCCCTCCAACGAGGAGATGTTCG
ACTTTGATCCGCTCGACGTTACGAAGACTTGGCCGGAGGAAATGTTCCCGCTCCAACCGGTTGGCCGCATGGTGCTCAACAAAAACATTGACAACTTCTTCGCGGAGAACGAGCAGCTTG
CGTTTTGTCCGGCGCTCATCGTCCCTGGCGTCTACTATACCGACGACAAGATGCTCCAGACTAGAATCTTCTCATACGCCGACACGCAGCGGCACCGACTTGGACCGAACTATCTCATGC
TGCCTGCAAATGCACCCAAGTGCGCACATCACAATAATCATCACGAAGGCTTTATGAACTTCATGCACAGGGATGAGGAG
GTATGGTGGTGGAATGTTCTCCAGTTTTTTCTTTGTTTGA
GCTTTTTTTAATGATTTGTACTCGTTCTGTCTTTTGATTTTTCTAACCACTCGTCGTGAACTGTCAAACACAGGTGAACTATTTTCCATCACGATTCGACGCAGTTCGCCACGCCGAGCA
AGTCCCGATTCCCTCACGTCCTGTGAGTGGCCGCCGAGAAAAG
GTAGAGAAAAGCTTTGGCTTGTTTAAGCCTGGATGCCAGCTTCAAAGTCTTGACCGGTGCGTGCACAGGTGATGCTG
GAAAAAGAGAACAATTTCGCACAACCTGGCGTGAGGTACAGATCATGGCCAGCTGACAG
GTGAGCGAGCAATGTCGTGCAAAAACTTCTGCCCATGTTTTTCTTCCATTTTTCTTTTTTT
TTTCCTTCCTTCTCTCGCTCTTTCTCTCTCTTTCTCTCTCTCACTCGCTTGAGGATCTGGTGGTCGTGCAAAGCAAAGTTTCCTAACTTTTGTGTTACACTGACTGTCTTTGCTTGGCAG

GCAAGAGAGGTTCATTGAGAATTGGGTGGACGCTCTATCCGATTCACGCGTTACTCATGAAATACGCAGTGTGTGGATTTCGTATTGGTCCCAG
GTACGTAGCTTGTTTTCTTATCCTTT
CTTTTTTATCCTTCGACCGTCTCGATAGTGGACGGCATGCTAATTGTCTTTCTGCTTAACGCGTGCAGTGCGATAAGTCCCTCGGCCAGCGAATCGCGGCTCAACTTCAGTCCAAATCCA
ACATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGCACACTCCATCAAGCGCTTTCAATTCTTCTTTTTTCACCACAAACTCTGGCACTCCCGTCTGGAACAACAATTCCTCTTTGACAGTTGGGTCACGAGGGCCTATT
CTGCTGGAAGATTATCACTTGATCGAGAAGCTTGCTCAGTTTGACAGGGAACGCATTCCCGAGCGCGTCGTCCATGCGCGTGGAGCAAGTGCAAAGGGTTACTTTGAAGTCACCCACGAC
ATCTCAAACCTCACCTGCGCGGATTTCCTGCGTGCACCTGGAGTCCAGACACCGCTGATTGTGAGGTTCTCCACCGTCATTCACGAACGTGGAAGCCCCGAGACACTCCGTGATCCCAGA
GGCTTTGCCGTCAAATTCTACACGCGGGAG
GGAAACTTCGATCTGGTTGGAAACAACATTCCCGTGTTCTTCGTACGTGATGGCATCAAGTTCCCTGACATGATCCACGCTCTCAAGCCA
AACCCAAAGACGCATGTTCAAGAGCCTTGGCGCATTATGGACCACTTCTCGCATCATCCGGAGAGCTGTCACATGTTTACTTTTCTCTTCGACGACCACGGAATTCCTCTCAATTACCGT
CACATGGAAGGCTTCGGGGTACACACGTTCACTCTGGTCAATCGCGCCGGCAAGTGTACGTATGTCAAGTTCCACTGGAAGCCAACTTGCGGACTAAAGTATCTGAGCAAGCAAGAGGCT
GTGGTCGTCGGCGGCTCTAATCACAGCCATGCAACCAAGGATCTCTACGACTCCATCGCGGCCGGAAACTATCCAGAGTGGAAGCTGTTCATTCAGACTATGAACCCCTCCAACGAGGAG
ATGTTCGACTTTGATCCGCTCGACGTTACGAAGACTTGGCCGGAGGAAATGTTCCCGCTCCAACCGGTTGGCCGCATGGTGCTCAACAAAAACATTGACAACTTCTTCGCGGAGAACGAG
CAGCTTGCGTTTTGTCCGGCGCTCATCGTCCCTGGCGTCTACTATACCGACGACAAGATGCTCCAGACTAGAATCTTCTCATACGCCGACACGCAGCGGCACCGACTTGGACCGAACTAT
CTCATGCTGCCTGCAAATGCACCCAAGTGCGCACATCACAATAATCATCACGAAGGCTTTATGAACTTCATGCACAGGGATGAGGAG
GTGAACTATTTTCCATCACGATTCGACGCAGTT
CGCCACGCCGAGCAAGTCCCGATTCCCTCACGTCCTGTGAGTGGCCGCCGAGAAAAG
GTGATGCTGGAAAAAGAGAACAATTTCGCACAACCTGGCGTGAGGTACAGATCATGGCCAGCT
GACAG
GCAAGAGAGGTTCATTGAGAATTGGGTGGACGCTCTATCCGATTCACGCGTTACTCATGAAATACGCAGTGTGTGGATTTCGTATTGGTCCCAGTGCGATAAGTCCCTCGGCCAG
CGAATCGCGGCTCAACTTCAGTCCAAATCCAACATGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTT ACAAGCACAC TCCATCAAGC GCTTTCAATT CTTCTTTTTT CACCACAAAC TCTGGCACTC CCGTCTGGAA CAACAATTCC TCTTTGACAG TTGGGTCACG AGGGCCTATT  CTGCTGGAAG ATTATCACTT GATCGAGAAG CTTGCTCAGT TTGACAGGGA ACGCATTCCC GAGCGCGTCG TCCATGCGCG TGGAGCAAGT GCAAAGGGTT ACTTTGAAGT CACCCACGAC  ATCTCAAACC TCACCTGCGC GGATTTCCTG CGTGCACCTG GAGTCCAGAC ACCGCTGATT GTGAGGTTCT CCACCGTCAT TCACGAACGT GGAAGCCCCG AGACACTCCG TGATCCCAGA  GGCTTTGCCG TCAAATTCTA CACGCGGGAG GGAAACTTCG ATCTGGTTGG AAACAACATT CCCGTGTTCT TCGTACGTGA TGGCATCAAG TTCCCTGACA TGATCCACGC TCTCAAGCCA  AACCCAAAGA CGCATGTTCA AGAGCCTTGG CGCATTATGG ACCACTTCTC GCATCATCCG GAGAGCTGTC ACATGTTTAC TTTTCTCTTC GACGACCACG GAATTCCTCT CAATTACCGT  CACATGGAAG GCTTCGGGGT ACACACGTTC ACTCTGGTCA ATCGCGCCGG CAAGTGTACG TATGTCAAGT TCCACTGGAA GCCAACTTGC GGACTAAAGT ATCTGAGCAA GCAAGAGGCT  GTGGTCGTCG GCGGCTCTAA TCACAGCCAT GCAACCAAGG ATCTCTACGA CTCCATCGCG GCCGGAAACT ATCCAGAGTG GAAGCTGTTC ATTCAGACTA TGAACCCCTC CAACGAGGAG  ATGTTCGACT TTGATCCGCT CGACGTTACG AAGACTTGGC CGGAGGAAAT GTTCCCGCTC CAACCGGTTG GCCGCATGGT GCTCAACAAA AACATTGACA ACTTCTTCGC GGAGAACGAG  CAGCTTGCGT TTTGTCCGGC GCTCATCGTC CCTGGCGTCT ACTATACCGA CGACAAGATG CTCCAGACTA GAATCTTCTC ATACGCCGAC ACGCAGCGGC ACCGACTTGG ACCGAACTAT  CTCATGCTGC CTGCAAATGC ACCCAAGTGC GCACATCACA ATAATCATCA CGAAGGCTTT ATGAACTTCA TGCACAGGGA TGAGGAGGTG AACTATTTTC CATCACGATT CGACGCAGTT  CGCCACGCCG AGCAAGTCCC GATTCCCTCA CGTCCTGTGA GTGGCCGCCG AGAAAAGGTG ATGCTGGAAA AAGAGAACAA TTTCGCACAA CCTGGCGTGA GGTACAGATC ATGGCCAGCT  GACAGGCAAG AGAGGTTCAT TGAGAATTGG GTGGACGCTC TATCCGATTC ACGCGTTACT CATGAAATAC GCAGTGTGTG GATTTCGTAT TGGTCCCAGT GCGATAAGTC CCTCGGCCAG 
CGAATCGCGG CTCAACTTCA GTCCAAATCC AACATGTGA 

Retrieve as FASTA