Entry information : CcinKat02
Entry ID 6272
Creation 2008-07-11 (Marcel Zamocky)
Last sequence changes 2008-07-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinKat02
Name CcinKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type Sporocarp (fruiting body)
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinKat02
start..stop
S start..stop
AbKat02_bisporus 1102 0 1..721 1..726
PplKat03 1080 0 2..721 3..727
SlutKat03 1079 0 1..721 1..735
PcKat04 1065 0 3..721 2..724
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2484398..2484549 152 N° 2 2484602..2484860 259 N° 3 2484914..2485130 217 N° 4 2485186..2485386 201
N° 5 2485440..2485780 341 N° 6 2485837..2485985 149 N° 7 2486039..2486682 644 N° 8 2486737..2486938 202
N° 9 2487397..2488279 883  
join(2484398..2484549,2484602..2484860,2484914..2485130,2485186..2485386,2485440 ..2485780,2485837..2485985,2486039..2486682,2486737..2486938,2487397..2488279)


exon

Literature and cross-references CcinKat02
Literature Birren B.W., Lander E.S., Galagan J.E., Nusbaum C., Devon K., Ma L.-J., Jaffe D.B., Butler J., Alvarez P., Gnerre S., Grabherr M., Kleber M., Mauceli E.W., Brockman W., Rounsley S., Young S.K., LaButti K., Pushparaj V., DeCaprio D., Crawford M., Koehrsen M., Engels R., Montgomery P., Pearson M., Howarth C., Larson L., Luoma S., White J., Kodira C.D., Zeng Q., Alvarado L., Yandava C., Oleary S., Dietrich F.S., Pukkila P.J. Annotation of the Coprinopsis cinerea genome.
(unpublished since 2003)
Protein ref. UniProtKB:   A8NH39
DNA ref. JGI genome:   Chr_2 (2484398..2488276)
EST ref. GenBank:   DN591769.1
Protein sequence: CcinKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1015
PWM (Da):   %s   112666.84  
PI (pH):   %s   7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSIGSTLKHAMNTVVGDAKTRDLQRDTVVPTRNSAMTTDYGAKMSDTDHWLSVSDGSKVGPALLEDQIAREKIHRFDHERIPERVVHARGTGAHGEFRVFDHRASKYTSAPVLTDPSRTTPIFIRFSTVQGSRGSDCVRDVRGFAVKFYTPEGNWDLVANDIPVFFIQDAIKFPDFVHAVKPEPQNEVPQGQSAHNNFWDFVGLQPESAHMVMWTMSDRGIPRSYRMMQGFGVNTFTLINAKGERHFVKFHMTPELGVHSLVWDEALKINGQDPDFHRKDLAEAIHAGCYPKWTFGIQVIPEKDEHNFDFDILDATKIWPEELVPLQPIGELVLNRTVDEYFPEVEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGINWELPINRPVCPVMNINRDGKMQMRIHKTNLNYFPNRDSIVNPVPPAEGGYVEFMEKIVGLKQRVRGAKFQEHYNQAQLFWNSLTPWEKEHTINAFAFELSHCDDQRVYERYTTILNNVDFELAKAVAIKVNGVVPEKPARPNHGRSSAPLSQFYYAPKKPIIATRRIAIIVADGFHEAEVLAVRSLLASAKATTWIIGPRRAAVKAAGGGRLVADHSLEDQRSTLFDAVYIPSGEEHAKTLIGNGRAIHWIREAFGHCKAIGAVGGVSVVNHALNLPEVKLFTAPNDDTVLTSYGVVTTGKYGVKSAATDVLQIEPGPKGFVSNFAYEISKHSNLAKKKSPAEASAGNVELPPSPAPQSGANVPVRPLSNQSGEESDNNSEATKDLKVPEKPPTSRRPSKQTHKEPEKPPVQAPPPPRPSSRRSKSGAMSGPTSYPKGVITLLMNMIPRMAVNPKFTGEQESFMLWNAILNTHFPADMGYGITFHKTVDSKDGDDFTNYLVVKLIREGEESTVLVVTVRKNADDSSPGREAVEKKAMEYVDSPGFDETEFPDIYSITSVGLSWAGTKMEEPKTEKYLDGSEKPESLVDWTTNMASAVSFEKLKSIAGKVHSMTHQYRRGGDSKNQG

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 6 ESTs. Strain="Okayama-7/130/FGSC 9003".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCATTGGATCTACCCTCAAGCACGCCATGAACACCGTTGTCGGCGATGCCAAAACCCGCGACCTCCAGCGCGACACCGTCGTGCCCACCAGAAACTCGGCCATGACCACCGAC
TATGGCGCGAAGATGTCTGATACAGACCATTG
GTGCGTTCTTCCCCGCGTCTTTGCCAAACCTCGATTGACCTGTCCCCTATAGGCTCTCTGTATCAGACGGTTCCAAAGTCGGTCCAGC
GCTGCTGGAAGACCAGATCGCTCGAGAGAAGATCCACCGATTCGACCATGAGCGTATCCCTGAGCGAGTCGTTCACGCTCGTGGCACGGGTGCTCATGGCGAGTTTCGCGTGTTCGACCA
CCGAGCATCCAAGTACACATCTGCACCTGTTTTGACTGACCCGTCGCGCACCACGCCCATCTTCATTCGCTTCAGTACCGTACAGGGCTCCAGAGGAAGTGCT
GTACGTCAACCCGCCTT
TACACATTTGACTGTTTTCACTCAACCCTCGACCAGGATTGTGTTCGCGATGTGCGAGGCTTCGCGGTCAAGTTCTACACGCCTGAAGGGAACTGGGACCTTGTCGCCAATGACATCCCA
GTATTCTTTATCCAGGATGCCATCAAGTTCCCCGATTTCGTTCACGCTGTGAAGCCCGAGCCGCAGAATGAAGTGCCTCAGGGCCAATCCGCTCATAACAACTTCTGGGACTTCGTCGGT
CTCCAGCCTGAAT
GTGAGTATATCTCTTCACATGGTGCCCCATCAACGACTAAATGTATTCTTGATAGCCGCCCACATGGTTATGTGGACGATGTCGGACAGAGGCATCCCTCGTTCGTA
TCGCATGATGCAAGGCTTTGGCGTCAATACCTTTACTCTAATCAACGCCAAAGGCGAGCGACACTTTGTCAAGTTCCATATGACTCCTGAGTTGGGTGTCCATAGTCTGGTGTGGGACGA
AGCTCTGAAGATCAACGGCCAGGATCCAG
GTACATCTGTACTCTCAGACATTTTCTCCTCCGATGCTAACCTGCAACTTCAGATTTCCACCGCAAAGATCTGGCTGAAGCCATTCACGCC
GGCTGTTATCCAAAGTGGACCTTCGGCATCCAAGTCATTCCTGAGAAGGACGAGCACAACTTTGATTTTGATATCCTTGATGCAACGAAGATCTGGCCCGAGGAGCTTGTTCCTTTGCAA
CCTATTGGAGAGCTCGTGCTGAACAGAACTGTTGATGAATACTTCCCCGAGGTTGAGCAAGTTGCTTTCTGTACTAGCCATGTCGTTCCAGGCATTGGCTTCAGCGACGACCCCCTTCTT
CAAGGACGAAACTTTTCCTATTTCGACACACAGATCAGTCGACTTGGTATCAATTGGGAGCAG
GTATGCAGCCCCTTTGAAGCTGTTTGCCGCAGCATATATATTGATACGCATCCCAGC
TCCCTATTAACAGACCCGTCTGCCCTGTCATGAACATCAACCGAGACGGCAAGATGCAGATGAGGATTCACAAGACGAACCTCAATTACTTCCCCAATCGTGACTCGATCGTCAACCCAG
TCCCTCCCGCTGAAGGCGGCTACGTCGA
GTGGGTAGTACATGACATGTTCCATACCATCTTTGGCTGAACAACATCTTTAGGTTTATGGAGAAGATTGTTGGGCTGAAGCAGCGAGTGCG
CGGTGCCAAGTTCCAGGAACATTATAACCAAGCTCAGCTCTTCTGGAACTCACTCACTCCTTGGGAAAAAGAGCATACCATCAATGCCTTTGCCTTCGAATTGAGTCACTGCGACGATCA
ACGGGTCTACGAGCGCTACACGACAATTCTCAACAACGTCGACTTCGAATTGGCTAAGGCTGTTGCGATCAAGGTCAACGGTGTTGTCCCGGAGAAGCCAGCGCGCCCCAACCACGGTCG
CTCGTCAGCTCCCTTGTCGCAATTCTACTATGCTCCGAAGAAACCCATCATCGCCACTCGCCGCATCGCAATCATTGTAGCTGACGGGTTCCACGAGGCAGAGGTCCTCGCCGTCCGTAG
CCTGCTGGCGAGCGCTAAAGCCACGACTTGGATCATTGGGCCCCGTCGTGCTGCGGTCAAGGCCGCCGGTGGAGGACGGCTAGTCGCGGACCACTCGTTGGAGGATCAGCGCTCGACTCT
CTTCGACGCTGTCTACATCCCCTCCGGAGAAGAGCACGCGAAGACACTCATTGGCAATGGTCGTGCTATCCATTGGATTCGCGAGGCCTTCGGGCATTGCAAGGCCATCGGTGCCGTTGG
CGAAG
GTTCGTGGTCGATCCCCTTGATTCTGGCCTGTGACTTATCTTTCTCTTTACTAGGTGTCTCCGTTGTCAACCACGCCCTCAACCTTCCCGAAGTCAAACTCTTCACTGCTCCCAA
CGATGACACCGTCCTTACATCCTACGGTGTCGTCACGACTGGGAAGTACGGTGTGAAGTCAGCAGCGACTGACGTTCTCCAGATTGAGCCTGGGCCAAAGGGCTTCGTCTCCAACTTTGC
ATATGAAATTAGCAAGCACAG
GTGTTTTGAGCGGGAATTGGATGGGCTCACGGCCAAGGTAGCTTATTAGATAGTTTAGTTTATAGAAAGACAATGTGGACTTTATGTTGTAGTATTAGA
CTTCGGTGTTCGCGCAAATGTAACATAGTGGTGTCGCAGTTCTCTGGAATCTCGCTGTGCCTCCCTGACGCCTGCCCCTAATTCTCCAGCGCTTAACCCGCTTATCCTAATGAATGGGCC
AGTACAGACTAATGACGCTCACAGGCCAGAGAATGCTTGTTCGATCGTGGATTCGTGACGTCTCGGGTCGATCCTGAAACAGCCCCTTTGCCTCCTTGTCCAAGGCCATAAAACCCCATC
GCATTCGATCTTTCCCAACCAAGCAAACGTCCGCAATCTCAGCCTCGAACCAAGCACTTTCTTTTTATTTGCAAACCCGTCACCACGGCCTCAATATCAGTCCAACTCCCTGCAGTCAGC
AACCTGGCGAAGAAAAAATCTCCAGCCGAGGCTTCAGCCGGCAACGTCGAGCTTCCTCCCTCACCCGCACCCCAGTCTGGGGCCAACGTACCCGTCAGACCACTTTCGAATCAGTCCGGC
GAAGAGTCCGACAACAACTCTGAGGCAACCAAGGACCTCAAAGTTCCGGAGAAGCCGCCCACCTCTCGTCGCCCTTCGAAGCAAACACATAAGGAGCCCGAGAAGCCTCCCGTTCAAGCA
CCCCCTCCCCCTCGCCCCTCCAGCAGACGCTCCAAGTCCGGTGCCATGTCTGGCCCAACCAGCTACCCCAAGGGCGTCATCACCCTGTTGATGAACATGATCCCCCGCATGGCGGTGAAC
CCCAAGTTCACGGGCGAACAGGAATCGTTCATGCTCTGGAACGCGATCCTCAACACCCACTTTCCCGCCGACATGGGATACGGTATCACCTTCCACAAGACCGTCGACTCGAAGGATGGC
GACGATTTCACCAACTATCTCGTGGTTAAACTCATTCGCGAAGGTGAAGAGAGCACGGTCCTCGTCGTCACCGTCCGCAAGAACGCCGACGATAGTTCCCCCGGGAGGGAGGCTGTGGAG
AAGAAGGCCATGGAATACGTTGACTCCCCTGGGTTCGACGAGACTGAGTTTCCAGACATCTACTCCATCACCAGTGTCGGTTTGTCGTGGGCGGGGACGAAGATGGAGGAGCCCAAAACG
GAGAAGTACCTCGATGGGTCTGAGAAACCGGAGAGTTTGGTGGACTGGACGACCAACATGGCCTCTGCTGTTTCGTTTGAGAAGTTGAAGTCAATCGCGGGAAAGGTCCACAGTATGACG
CACCAGTATCGACGAGGAGGGGATTCCAAGAACCAGGGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCATTGGATCTACCCTCAAGCACGCCATGAACACCGTTGTCGGCGATGCCAAAACCCGCGACCTCCAGCGCGACACCGTCGTGCCCACCAGAAACTCGGCCATGACCACCGAC
TATGGCGCGAAGATGTCTGATACAGACCATTG
GCTCTCTGTATCAGACGGTTCCAAAGTCGGTCCAGCGCTGCTGGAAGACCAGATCGCTCGAGAGAAGATCCACCGATTCGACCATGAG
CGTATCCCTGAGCGAGTCGTTCACGCTCGTGGCACGGGTGCTCATGGCGAGTTTCGCGTGTTCGACCACCGAGCATCCAAGTACACATCTGCACCTGTTTTGACTGACCCGTCGCGCACC
ACGCCCATCTTCATTCGCTTCAGTACCGTACAGGGCTCCAGAGGAAGTGCT
GATTGTGTTCGCGATGTGCGAGGCTTCGCGGTCAAGTTCTACACGCCTGAAGGGAACTGGGACCTTGTC
GCCAATGACATCCCAGTATTCTTTATCCAGGATGCCATCAAGTTCCCCGATTTCGTTCACGCTGTGAAGCCCGAGCCGCAGAATGAAGTGCCTCAGGGCCAATCCGCTCATAACAACTTC
TGGGACTTCGTCGGTCTCCAGCCTGAAT
CCGCCCACATGGTTATGTGGACGATGTCGGACAGAGGCATCCCTCGTTCGTATCGCATGATGCAAGGCTTTGGCGTCAATACCTTTACTCTA
ATCAACGCCAAAGGCGAGCGACACTTTGTCAAGTTCCATATGACTCCTGAGTTGGGTGTCCATAGTCTGGTGTGGGACGAAGCTCTGAAGATCAACGGCCAGGATCCAG
ATTTCCACCGC
AAAGATCTGGCTGAAGCCATTCACGCCGGCTGTTATCCAAAGTGGACCTTCGGCATCCAAGTCATTCCTGAGAAGGACGAGCACAACTTTGATTTTGATATCCTTGATGCAACGAAGATC
TGGCCCGAGGAGCTTGTTCCTTTGCAACCTATTGGAGAGCTCGTGCTGAACAGAACTGTTGATGAATACTTCCCCGAGGTTGAGCAAGTTGCTTTCTGTACTAGCCATGTCGTTCCAGGC
ATTGGCTTCAGCGACGACCCCCTTCTTCAAGGACGAAACTTTTCCTATTTCGACACACAGATCAGTCGACTTGGTATCAATTGGGAGCAG
CTCCCTATTAACAGACCCGTCTGCCCTGTC
ATGAACATCAACCGAGACGGCAAGATGCAGATGAGGATTCACAAGACGAACCTCAATTACTTCCCCAATCGTGACTCGATCGTCAACCCAGTCCCTCCCGCTGAAGGCGGCTACGTCGA
G
TTTATGGAGAAGATTGTTGGGCTGAAGCAGCGAGTGCGCGGTGCCAAGTTCCAGGAACATTATAACCAAGCTCAGCTCTTCTGGAACTCACTCACTCCTTGGGAAAAAGAGCATACCATC
AATGCCTTTGCCTTCGAATTGAGTCACTGCGACGATCAACGGGTCTACGAGCGCTACACGACAATTCTCAACAACGTCGACTTCGAATTGGCTAAGGCTGTTGCGATCAAGGTCAACGGT
GTTGTCCCGGAGAAGCCAGCGCGCCCCAACCACGGTCGCTCGTCAGCTCCCTTGTCGCAATTCTACTATGCTCCGAAGAAACCCATCATCGCCACTCGCCGCATCGCAATCATTGTAGCT
GACGGGTTCCACGAGGCAGAGGTCCTCGCCGTCCGTAGCCTGCTGGCGAGCGCTAAAGCCACGACTTGGATCATTGGGCCCCGTCGTGCTGCGGTCAAGGCCGCCGGTGGAGGACGGCTA
GTCGCGGACCACTCGTTGGAGGATCAGCGCTCGACTCTCTTCGACGCTGTCTACATCCCCTCCGGAGAAGAGCACGCGAAGACACTCATTGGCAATGGTCGTGCTATCCATTGGATTCGC
GAGGCCTTCGGGCATTGCAAGGCCATCGGTGCCGTTGGCGAAG
GTGTCTCCGTTGTCAACCACGCCCTCAACCTTCCCGAAGTCAAACTCTTCACTGCTCCCAACGATGACACCGTCCTT
ACATCCTACGGTGTCGTCACGACTGGGAAGTACGGTGTGAAGTCAGCAGCGACTGACGTTCTCCAGATTGAGCCTGGGCCAAAGGGCTTCGTCTCCAACTTTGCATATGAAATTAGCAAG
CACAG
CAACCTGGCGAAGAAAAAATCTCCAGCCGAGGCTTCAGCCGGCAACGTCGAGCTTCCTCCCTCACCCGCACCCCAGTCTGGGGCCAACGTACCCGTCAGACCACTTTCGAATCAG
TCCGGCGAAGAGTCCGACAACAACTCTGAGGCAACCAAGGACCTCAAAGTTCCGGAGAAGCCGCCCACCTCTCGTCGCCCTTCGAAGCAAACACATAAGGAGCCCGAGAAGCCTCCCGTT
CAAGCACCCCCTCCCCCTCGCCCCTCCAGCAGACGCTCCAAGTCCGGTGCCATGTCTGGCCCAACCAGCTACCCCAAGGGCGTCATCACCCTGTTGATGAACATGATCCCCCGCATGGCG
GTGAACCCCAAGTTCACGGGCGAACAGGAATCGTTCATGCTCTGGAACGCGATCCTCAACACCCACTTTCCCGCCGACATGGGATACGGTATCACCTTCCACAAGACCGTCGACTCGAAG
GATGGCGACGATTTCACCAACTATCTCGTGGTTAAACTCATTCGCGAAGGTGAAGAGAGCACGGTCCTCGTCGTCACCGTCCGCAAGAACGCCGACGATAGTTCCCCCGGGAGGGAGGCT
GTGGAGAAGAAGGCCATGGAATACGTTGACTCCCCTGGGTTCGACGAGACTGAGTTTCCAGACATCTACTCCATCACCAGTGTCGGTTTGTCGTGGGCGGGGACGAAGATGGAGGAGCCC
AAAACGGAGAAGTACCTCGATGGGTCTGAGAAACCGGAGAGTTTGGTGGACTGGACGACCAACATGGCCTCTGCTGTTTCGTTTGAGAAGTTGAAGTCAATCGCGGGAAAGGTCCACAGT
ATGACGCACCAGTATCGACGAGGAGGGGATTCCAAGAACCAGGGATGA

Retrieve as FASTA