Entry information : PtritKat01 (Catalase A)
Entry ID 6275
Creation 2008-07-11 (Marcel Zamocky)
Last sequence changes 2008-07-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PtritKat01 (Catalase A)
Name (synonym) PtritKat01 (Catalase A)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritKat01
start..stop
S start..stop
CheKat02_C5 1453 0 1..740 1..740
CheKat02_C4 1453 0 1..740 1..740
PnoKat02 1328 0 1..740 1..743
CfulKat02 1126 0 32..740 36..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 979690..979920 231 N° 2 979966..980252 287 N° 3 980401..982105 1705  
join(979690..979920,979966..980252,980401..982105)


exon

Literature and cross-references PtritKat01 (Catalase A)
Literature Birren B., Lander E., Galagan J., Nusbaum C., Devon K., Ma L.-J., Jaffe D., Butler J., Alvarez P., Gnerre S., Grabherr M., Kleber M., Mauceli E., Brockman W., MacCallum I.A., Young S., LaButti K., DeCaprio D., Crawford M., Koehrsen M., Engels R., Montgomery P., Pearson M., Howarth C., Larson L., White J., Yandava C., Kodira C., Guigo R., Borodovsky M., Zeng Q., O'Leary S., Alvarado L., Pandelova I., Ciuffetti L. Genome Sequence of Pyrenophora tritici-repentis.(unpublished since 2007)
Protein ref. UniProtKB:   B2W544
DNA ref. JGI genome:   supercontig_1.4 (979690..982105)
Protein sequence: PtritKat01 (Catalase A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   83063.04  
PI (pH):   %s   6.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASEILGNAAEKAKGLVGEKTGKMAQLAAVTKDVHDDKWRITSDYGVKQNNTDDWLKVATDDQTGPSLLEDQFAREKIHRFDHERIPERVVHARGSGAFGKFTLFESAEDVTSAGVLTDTSRETPVFLRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDIVGNNIPVFFIQDSMKFPDVIHAGKPEPDCEVPQAQTAHNNFWDFTYSHSEATHMFMWAMSDRTIPRSYRMMQGFGVNTYTLMNAKGERHFVKFHFTPELGVHSFVWDEALKIAGQDPDFHRKDLWMAIESGAYPKWKFGIQVLPESKEHDFDFDILDATKIWPEELVPIRYIGELELNQNPDEFFTQTEQVAFCTSHIVPGIGFSNDPLLQGRNFSYQDTQLSRLGVNWEELPINKPVCPVMNFNRDGAMRHTITKGKVNYWPNRFQTVPPATEKEGAYIDFPEKTVGIKARMQSKKFREHKNQAELFYNSMSENEKMHMKDAFAFELDHCDDPVVYKRLCERLCEIDLELAQSVADMVGADQPTQQTRPKHNKKAKGLSQMEFMPQKPTIATRMVAILIADGYDQVAYNGIKAALTAAGALPFTISPRRNKIYADGEDRSGPGVVADHHLEGQRSTMYDSVFVPGGAKSIETLSKNGRAVHWVREAFGHLKAIGGTGEAVSFIKQAVDLHGMEFSAAGDVVNSYGVVTASKVQPESFKEAVNMAKEAMDFTSAYLFSISQHKNFERETAGLNQMVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="Pt-1C-BFP".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGAAATACTAGGAAACGCTGCGGAGAAGGCCAAGGGCCTCGTGGGTGAGAAGACGGGCAAGATGGCTCAACTCGCCGCCGTCACAAAGGATGTCCACGACGACAAGTGGCGC
ATCACCAGCGACTACGGTGTCAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCAACGGACGACCAGACTGGCCCTTCGCTGTTGGAGGATCAATTCGCTCGTGAGAAG
GTATGTAAT
CGCCACTTGTATCGAATTATGGTCTAACGTCCTCAGATCCACCGCTTCGACCACGAACGTATCCCCGAGCGCGTTGTCCACGCCCGTGGCTCAGGTGCCTTTGGTAAATTCACTCTCTTT
GAATCGGCAGAAGACGTCACATCTGCGGGTGTTTTGACGGATACATCGCGCGAAACCCCCGTCTTCCTACGATTCTCGACTGTCCTGGGCAGCCGTGGCTCAGCTGACACCGTTCGCGAT
GTACGTGGCTTTGCTGTCAAGTTCTACACAGAGGAGGGCAACTGGGATATCGTCGGAAACAACATTCCTGTGTTTTTCATCCA
GTAAGTCACAAATCACCACCACATAACCACAGGGGAA
ATGAGACATGCCTACTTTGTCTGGTATTGCTAGATATGTGGGGTTTGGGTGTCGTCTCTTCAATGTCTAGGATAACCCACGTAATCACGAAGTTTTACTAACTCACTCCAGGGACTCGAT
GAAGTTTCCTGACGTGATCCACGCAGGCAAGCCAGAGCCTGACTGCGAGGTTCCCCAGGCCCAGACTGCTCACAACAACTTCTGGGACTTCACTTACTCTCATTCAGAGGCTACGCATAT
GTTCATGTGGGCCATGTCAGATCGCACGATTCCCCGCTCGTATCGTATGATGCAGGGTTTTGGCGTCAACACTTACACACTGATGAACGCCAAGGGTGAGAGGCACTTTGTCAAGTTCCA
CTTTACACCCGAGCTTGGAGTACACAGCTTTGTGTGGGATGAAGCCCTCAAGATCGCCGGTCAAGACCCTGACTTCCACCGCAAGGATCTGTGGATGGCCATTGAAAGTGGCGCCTACCC
CAAGTGGAAGTTTGGTATCCAGGTTCTCCCTGAATCTAAGGAGCATGACTTCGATTTCGACATCCTCGACGCCACCAAGATTTGGCCCGAGGAATTGGTTCCTATCCGGTATATTGGTGA
GCTTGAACTCAACCAAAACCCAGACGAGTTCTTCACCCAGACCGAGCAAGTCGCCTTCTGCACAAGCCACATCGTCCCCGGTATCGGCTTCAGTAACGACCCTCTCCTCCAGGGACGCAA
CTTCTCTTACCAGGACACTCAGCTCTCTCGTCTTGGCGTTAACTGGGAGGAATTGCCCATCAACAAGCCCGTCTGTCCTGTCATGAACTTCAACCGCGACGGTGCTATGCGACACACAAT
CACCAAGGGTAAAGTCAACTACTGGCCTAACCGCTTCCAGACTGTGCCCCCTGCTACCGAGAAGGAGGGCGCTTACATCGACTTCCCCGAGAAGACTGTAGGCATCAAGGCTCGCATGCA
AAGCAAGAAGTTCAGGGAGCACAAGAACCAGGCTGAGCTCTTTTACAACTCCATGTCGGAGAACGAAAAGATGCACATGAAGGATGCTTTCGCCTTCGAACTTGACCACTGCGACGACCC
TGTAGTCTACAAGCGTCTCTGTGAGCGCCTATGCGAGATCGATCTTGAGCTTGCCCAGAGCGTTGCAGACATGGTTGGTGCCGATCAACCTACCCAGCAGACGCGCCCCAAGCACAACAA
GAAGGCCAAGGGTCTCTCGCAGATGGAATTTATGCCCCAGAAGCCCACCATTGCCACCCGCATGGTCGCCATTCTCATCGCCGATGGCTACGACCAGGTTGCATACAACGGCATCAAGGC
TGCTTTGACCGCGGCCGGAGCCCTTCCCTTCACCATCTCGCCACGGAGAAACAAGATCTACGCCGACGGCGAGGACCGCAGCGGCCCAGGCGTCGTAGCAGACCACCACCTCGAAGGCCA
GCGATCCACCATGTACGACAGTGTCTTCGTACCCGGCGGCGCAAAGTCAATTGAGACACTCAGCAAGAACGGACGTGCGGTACACTGGGTCCGTGAAGCATTTGGTCACCTCAAGGCCAT
TGGTGGAACCGGCGAGGCAGTCTCATTCATCAAGCAGGCCGTCGACCTTCACGGCATGGAGTTCTCGGCTGCCGGTGACGTGGTCAACTCGTACGGTGTTGTGACTGCCAGCAAAGTCCA
GCCCGAGAGCTTCAAGGAAGCTGTCAACATGGCCAAGGAAGCAATGGACTTCACTAGCGCGTACCTGTTTTCGATTTCTCAGCACAAGAACTTTGAGCGTGAGACTGCGGGCTTGAACCA
GATGGTTGCGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGAAATACTAGGAAACGCTGCGGAGAAGGCCAAGGGCCTCGTGGGTGAGAAGACGGGCAAGATGGCTCAACTCGCCGCCGTCACAAAGGATGTCCACGACGACAAGTGGCGC
ATCACCAGCGACTACGGTGTCAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCAACGGACGACCAGACTGGCCCTTCGCTGTTGGAGGATCAATTCGCTCGTGAGAAG
ATCCACCGC
TTCGACCACGAACGTATCCCCGAGCGCGTTGTCCACGCCCGTGGCTCAGGTGCCTTTGGTAAATTCACTCTCTTTGAATCGGCAGAAGACGTCACATCTGCGGGTGTTTTGACGGATACA
TCGCGCGAAACCCCCGTCTTCCTACGATTCTCGACTGTCCTGGGCAGCCGTGGCTCAGCTGACACCGTTCGCGATGTACGTGGCTTTGCTGTCAAGTTCTACACAGAGGAGGGCAACTGG
GATATCGTCGGAAACAACATTCCTGTGTTTTTCATCCA
GGACTCGATGAAGTTTCCTGACGTGATCCACGCAGGCAAGCCAGAGCCTGACTGCGAGGTTCCCCAGGCCCAGACTGCTCAC
AACAACTTCTGGGACTTCACTTACTCTCATTCAGAGGCTACGCATATGTTCATGTGGGCCATGTCAGATCGCACGATTCCCCGCTCGTATCGTATGATGCAGGGTTTTGGCGTCAACACT
TACACACTGATGAACGCCAAGGGTGAGAGGCACTTTGTCAAGTTCCACTTTACACCCGAGCTTGGAGTACACAGCTTTGTGTGGGATGAAGCCCTCAAGATCGCCGGTCAAGACCCTGAC
TTCCACCGCAAGGATCTGTGGATGGCCATTGAAAGTGGCGCCTACCCCAAGTGGAAGTTTGGTATCCAGGTTCTCCCTGAATCTAAGGAGCATGACTTCGATTTCGACATCCTCGACGCC
ACCAAGATTTGGCCCGAGGAATTGGTTCCTATCCGGTATATTGGTGAGCTTGAACTCAACCAAAACCCAGACGAGTTCTTCACCCAGACCGAGCAAGTCGCCTTCTGCACAAGCCACATC
GTCCCCGGTATCGGCTTCAGTAACGACCCTCTCCTCCAGGGACGCAACTTCTCTTACCAGGACACTCAGCTCTCTCGTCTTGGCGTTAACTGGGAGGAATTGCCCATCAACAAGCCCGTC
TGTCCTGTCATGAACTTCAACCGCGACGGTGCTATGCGACACACAATCACCAAGGGTAAAGTCAACTACTGGCCTAACCGCTTCCAGACTGTGCCCCCTGCTACCGAGAAGGAGGGCGCT
TACATCGACTTCCCCGAGAAGACTGTAGGCATCAAGGCTCGCATGCAAAGCAAGAAGTTCAGGGAGCACAAGAACCAGGCTGAGCTCTTTTACAACTCCATGTCGGAGAACGAAAAGATG
CACATGAAGGATGCTTTCGCCTTCGAACTTGACCACTGCGACGACCCTGTAGTCTACAAGCGTCTCTGTGAGCGCCTATGCGAGATCGATCTTGAGCTTGCCCAGAGCGTTGCAGACATG
GTTGGTGCCGATCAACCTACCCAGCAGACGCGCCCCAAGCACAACAAGAAGGCCAAGGGTCTCTCGCAGATGGAATTTATGCCCCAGAAGCCCACCATTGCCACCCGCATGGTCGCCATT
CTCATCGCCGATGGCTACGACCAGGTTGCATACAACGGCATCAAGGCTGCTTTGACCGCGGCCGGAGCCCTTCCCTTCACCATCTCGCCACGGAGAAACAAGATCTACGCCGACGGCGAG
GACCGCAGCGGCCCAGGCGTCGTAGCAGACCACCACCTCGAAGGCCAGCGATCCACCATGTACGACAGTGTCTTCGTACCCGGCGGCGCAAAGTCAATTGAGACACTCAGCAAGAACGGA
CGTGCGGTACACTGGGTCCGTGAAGCATTTGGTCACCTCAAGGCCATTGGTGGAACCGGCGAGGCAGTCTCATTCATCAAGCAGGCCGTCGACCTTCACGGCATGGAGTTCTCGGCTGCC
GGTGACGTGGTCAACTCGTACGGTGTTGTGACTGCCAGCAAAGTCCAGCCCGAGAGCTTCAAGGAAGCTGTCAACATGGCCAAGGAAGCAATGGACTTCACTAGCGCGTACCTGTTTTCG
ATTTCTCAGCACAAGAACTTTGAGCGTGAGACTGCGGGCTTGAACCAGATGGTTGCGTACTAA

Retrieve as FASTA