Entry information : ZmAPx01 (APx1 / GRMZM2G137839 [6a])
Entry ID 6378
Creation 2008-10-03 (Christophe Dunand)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx01 (APx1 / GRMZM2G137839 [6a])
Name (synonym) ZmAPx01 (APx1 / GRMZM2G137839 [6a])
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx01
start..stop
S start..stop
ZmAPx05 499 0 1..250 1..250
SbAPx01 493 4e-180 1..250 1..250
SiAPx01 486 2e-177 1..250 1..250
PamAPx01 483 5e-176 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43678530..43678648 119 N° 2 43678758..43678932 175 N° 3 43679033..43679098 66 N° 4 43680225..43680273 49
N° 5 43680414..43680499 86 N° 6 43680581..43680660 80 N° 7 43680809..43680911 103 N° 8 43680984..43681042 59
N° 9 43681115..43681130 16  
join(43678530..43678648,43678758..43678932,43679033..43679098,43680225..43680273 ,43680414..43680499,43680581..43680660,43680809..43680911,43680984..43681042,436 81115..43681130)


exon

Literature and cross-references ZmAPx01 (APx1 / GRMZM2G137839 [6a])
Literature REFERENCE 1 Bai,J. et al., Comparison of pathogen induced defense gene profiles on maize lines with different resistance genes. Unpublished (2003).
REFERENCE 2 Lai,J., Dey,N., Kim,C.S., Bharti,A.K., Rudd,S., Mayer,K.F., Larkins,B.A., Becraft,P. and Messing,J. Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res. 14 (10A), 1932-1937 (2004).
REFERENCE 3 Wilson,R.K., Higginbotham,J., Marchetto,P. and Ochoa,K. The sequence of Zea mays bac clone ZMMBBb-125N17.
Protein ref. UniProtKB:   B4FS18   B6U9S6 [Other strain]
mRNA ref. GenBank:   BT017015
Cluster/Prediction ref. UniGene:   Zm.20027
Protein sequence: ZmAPx01 (APx1 / GRMZM2G137839 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27282.85  
PI (pH):   %s   6.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKNYPTVSAEYSEAVDKARRKLRALIAEKSCAPLMLRLAWHSAGTFDVSSRTGGPFGTMKHQSELAHGANAGLDIAVRLLEPIKEEFPILSYADFYLAGVVAVEVTGGPEIPFHPGREDKPQPPPEGRLPDATKGSDHLRQVFGKQMGLSDQDIVALSGGHTGRCHKERSGFEGAWTTNPLVFDNSYFKELLSGDKEGLLQLPSDKALLSDPVFRPLVEKYADEKAFFDDYKEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 8 introns), 1 mRNA and 453 ESTs. Also found in AC202041.4.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAACTACCCGACCGTGAGCGCCGAGTACAGCGAGGCTGTGGACAAGGCCAGGCGCAAGCTCCGAGCCCTCATCGCCGAGAAGAGCTGCGCCCCGCTCATGCTCCGCCTCGCG
TAAGCCTCTTCTCCCCCACCTACCTCCCCTGCGCTGCGCGCGGATTTCCAGATCTTCGTGGGCGAGTTTTTTCGGTTGCATGATTTGGGTTTCCGTTTGGTCGCGCAGGTGGCACTCCGC
GGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCATTCGGCACGATGAAGCATCAGTCGGAATTGGCTCACGGCGCTAACGCGGGGCTGGACATCGCGGTGCGGCTGCTCGAGCCCAT
CAAGGAGGAGTTCCCAATCCTCTCTTACGCCGATTTCTACCAG
GTCTGTCCCTGACCCCGCATCGATCTGGTTGAATGATTCGATCTGCCTGAACGGATGTGCGTTTTGACCACGTACCT
TTCTGTCTCTGCTCCTGTTGCAGCTCGCGGGAGTTGTGGCCGTGGAGGTCACCGGTGGGCCTGAGATTCCCTTCCACCCCGGTAGGGAGGTGAGATTTTCGTCCTTTTTTTTGTCGTCCA
TCTTTATCTGCCTTTGGGTTTAGCCAGGGCTTAACCTTTTGTTTCGAAATCTCCGAAGAGGTTGGTGTGAAGATCGTTTGGTTAGATCGTGGTTGCTTAGTACGACCTATCTATTTGCCT
TTTACCATTTGCTTGGTAGATACCTCTTACAGTTAGCGATAACCATTTCTTCATGACACGTGATTTTATCGCTGCAGGTAACCTTTGTTTTCCTGTAAGCTTTGTCTCTGATGTTTGTGT
CCACTAGTTCAGGTTTCGATTATTTTATAGATATCATATTGAACATTGTGCTGTGAAAGTTAATTTACCCATTTAGTGTAATCTTCCTCAATATATGAGATACAGCTGTCAGTATGTGTA
TAGTTAGTACTCCGTATTTCATTGTTTGTTTGCATTCCTTGTCTCTTGTAGATGTGGTAGGGTAGTCCTATTACTAACTCTAATGATTTTTTTTTCATACTTACAGCTCTCCAGGGTGTT
TGAGGAAAAACATCAAAAAATTTGTTGCTTTTAGAAGCTGTTTCTAACATCAATGGTTCCTTGGCAATTAGAAAATGTTCATATAGCCTTCGTTTTGTGAAGTACTGTTGAAATGCTTGA
TTTCTCATGGACAAATAATCAGCCGTTTTGTCATTTCATATTGGTGTTCTCCATCCAACTTTTTAGTGCTTTGAATGATTATATATACTTATTCACAGTACCTGTTTTGTGCCGTCTAGA
TAGTTCTGGTTGCCTTACCCAGATGATGTTGTGCATTATGCAGACCACGCACACGTATGATCCCAGTTGATACGTTGTCATATTATACACATAGACCATAAATTTTCTGCATGTTGTCTA
AAGCTATCTATTTTCCCGTGATTTGTCATTATGATGTTGGGTGACAATTAGTTAACATTTGGTGATAAAGTTGTTTGCTTATACCCCCCTTTTTCTCTTGAAATTCTTATAAGTATAGAG
ATTGCTCTTGAAATTCTTACAAGTATAGAGATTGGCATGACTGACTGATAGTATTTTTTGTTCCACCCCTTTTTTGTCACCAATGTTTGTCAATGTAAACACCTAAGTATTTACATCTTT
TATTGTCTCTTTCAGGACAAGCCTCAGCCCCCACCTGAGGGCCGCCTTCCTGATGCCACTAAGGGTAGATCTCTCGTCTTCACTATGATTGTCTTGAATGATGAATTGATTGGTTATATT
TACCACATGTTCTTCATTTGCCAATTTTCTTGGCTAGGATATACTATACTGTCATTGATTTCTTGCTGCCCCTTTTTTAACCAGGTTCTGACCACCTGAGGCAAGTTTTTGGCAAGCAGA
TGGGCTTGAGCGATCAGGACATTGTTGCCCTCTCTGGTGGCCACACCTTG
GTTTGTTACTGTCACTCATGTTTGTTTCAGGTATGTAATATGTATGCTTGCACTTATTTAATTTTCTTGA
GGTTTATTTAGGGAAGGTGCCACAAAGAGCGGTCTGGTTTCGAGGGGGCCTGGACTACAAACCCTTTGGTCTTTGACAACTCTTACTTCAAGTGAGTCTTAGTCTCGTTTACTATTGAAA
AGCAACTGCATTTAGTTAGGAAATACTTAAAATTTGTTTACCTTGTTATGTCATTCCTGGCCAGCTGACTGCTACACTAGAAATCAATCTATTCCATTTCTCCCAAACTATTTTCGTAGG
GAACTTCTGAGTGGTGATAAGGAGGGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGAGTGACCCTGTCTTCCGCCCTCTTGTCGAGAAATATGCTGCG
GTATGTCTTTCGGTATTG
TTATAGGTTATTATGGAGATCTGTAACCCACTGATTATTTGGTGTGCCTTGTAGGATGAGAAGGCTTTCTTTGATGACTACAAAGAGGCCCACCTCAAGCTCTCCGAACTGGGGTAACCA
TTGATTGCACAAATTGTGCTTGGTCAATTTTAACAAATTTGATCGTTTACTCTTGTGGAATGCAGGTTTGCTGATGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAACTACCCGACCGTGAGCGCCGAGTACAGCGAGGCTGTGGACAAGGCCAGGCGCAAGCTCCGAGCCCTCATCGCCGAGAAGAGCTGCGCCCCGCTCATGCTCCGCCTCGCG
TGGCACTCCGCGGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCATTCGGCACGATGAAGCATCAGTCGGAATTGGCTCACGGCGCTAACGCGGGGCTGGACATCGCGGTGCGGCTG
CTCGAGCCCATCAAGGAGGAGTTCCCAATCCTCTCTTACGCCGATTTCTACCAG
CTCGCGGGAGTTGTGGCCGTGGAGGTCACCGGTGGGCCTGAGATTCCCTTCCACCCCGGTAGGGAG
GACAAGCCTCAGCCCCCACCTGAGGGCCGCCTTCCTGATGCCACTAAGGGTTCTGACCACCTGAGGCAAGTTTTTGGCAAGCAGATGGGCTTGAGCGATCAGGACATTGTTGCCCTCTCT
GGTGGCCACACCTTG
GGAAGGTGCCACAAAGAGCGGTCTGGTTTCGAGGGGGCCTGGACTACAAACCCTTTGGTCTTTGACAACTCTTACTTCAAGGAACTTCTGAGTGGTGATAAGGAG
GGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGAGTGACCCTGTCTTCCGCCCTCTTGTCGAGAAATATGCTGCG
GATGAGAAGGCTTTCTTTGATGACTACAAAGAGGCCCACCTC
AAGCTCTCCGAACTGGG
GTTTGCTGATGCTTAA

Retrieve as FASTA