Entry information : ZmKat2 (Cat2 / GRMZM2G090568 [6a])
Entry ID 6438
Creation 2008-12-24 (Cyril Jourda)
Last sequence changes 2008-12-24 (Cyril Jourda)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmKat2 (Cat2 / GRMZM2G090568 [6a])
Name (synonym) ZmKat2 (Cat2 / GRMZM2G090568 [6a])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Peroxisomal
Tissue types Leaves
Meristems
Shoots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmKat2
start..stop
S start..stop
SbKat02 973 0 1..493 1..492
OsKat03 920 0 1..493 1..492
ZaKat01 889 0 1..493 1..492
NtKat01-1A 887 0 1..493 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7162544..7162558 15 N° 2 7161209..7162453 1245 N° 3 7161032..7161099 68 N° 4 7160860..7160953 94
N° 5 7160687..7160746 60  
complement(join(7160687..7160746,7160860..7160953,7161032..7161099,7161209..7162 453,7162544..7162558))


exon

Literature and cross-references ZmKat2 (Cat2 / GRMZM2G090568 [6a])
Literature REFERENCE 1 Guan L., Ruzsa S., Skadsen R.W., Scandalios J.G. Comparison of the cat2 complementary DNA sequences of a normal catalase activity line (W64A) and a high catalase activity line (R6-67) of maize. Plant Physiol. 96:1379-1381(1991)
REFERENCE 2 Guan L., Polidoros A.N., Scandalios J.G. Isolation, characterization and expression of the maize Cat2 catalase gene. Plant Mol. Biol. 30:913-924(1996)
Protein ref. UniProtKB:   P12365 [Mismatch]
DNA ref. GenBank:   AC191330.3 (51141..53012)
mRNA ref. GenBank:   X54819
Cluster/Prediction ref. UniGene:   Zm.157
Protein sequence: ZmKat2 (Cat2 / GRMZM2G090568 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   56346.09  
PI (pH):   %s   7.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSAFNAPYWTTNSGAPVWNNDSSLTVGARGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNWDLVGNNFPVFFIRDGIKFPDMVHALKPNPRTHIQDNWRILDFFSHHPESLHMFSFLFDDVGIPADYRHMDGSGVHTYTLVSRAGTVTYVKFHWRPTCGVRSLMDDEAVAVGGANHSHATKDLTDAIAAGNFPEWTLYIQTMDPEMEDRLDDLDPLDVTKTWPEDAFPLQPVGRLVLNRNIDNFFAENEQLAFCPGLIVPGIYYSDDKLLQTRIFSYSDTQRHRLGPNYLLLPANAPKCAHHNNHYDGSMNFMHRHEEVDYFPSRYDAVRNAPRYPIPTAHIAGRREKTVISKENNFKQPGERYRAMDPARQERFITRWVDALSDPRLTHEIRTIWLSNWSADRSLGQKLASRLSAKPSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 4 introns), 5 mRNA and 76 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCGTACAAGGTACGCCGTTCTTGTTTGCTGTCTCAATTCGTGTTTCGTCGTTGACGATGGATCGGACGGCTGTTCATATATGCATGCATGCTTGTGCAGCACCGCCCGTCGAGC
GCCTTCAACGCCCCGTACTGGACCACCAACTCCGGCGCCCCCGTGTGGAACAACGACAGCTCCCTCACCGTCGGCGCACGAGGTCCCATCCTGCTGGAGGACTACCACCTGGTGGAGAAG
CTAGCCAACTTCGACCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGTGGCGCCAGCGCCAAGGGCTTCTTCGAGGTGACCCACGACATCACCCACCTGACGTGCGCCGACTTCCTG
CGCGCGCCCGGGGTGCAGACGCCCGTCATCGTCCGCTTCTCCACGGTGATCCACGAGCGCGGGAGCCCCGAGACGCTGCGCGACCCGCGCGGGTTCGCCGTCAAGTTCTACACCCGGGAG
GGCAACTGGGACCTGGTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCGGACATGGTGCACGCGCTCAAGCCCAACCCGCGGACGCACATCCAGGACAACTGG
CGCATCCTCGACTTCTTCTCGCACCACCCGGAGAGCCTGCACATGTTCTCCTTCCTCTTCGACGACGTCGGCATCCCCGCCGACTACCGCCACATGGACGGATCCGGGGTGCACACGTAC
ACGCTCGTCAGCCGCGCCGGCACCGTCACCTACGTCAAGTTCCACTGGCGCCCCACCTGCGGCGTGCGCTCGCTGATGGACGACGAGGCCGTCGCCGTTGGCGGCGCCAACCACAGCCAC
GCCACCAAGGACCTCACGGACGCCATCGCGGCGGGGAACTTCCCCGAGTGGACGCTCTACATCCAGACCATGGACCCCGAGATGGAAGACCGCCTCGACGACCTGGACCCGCTGGACGTG
ACCAAGACGTGGCCCGAGGACGCGTTCCCGCTGCAGCCCGTGGGCCGCCTGGTGCTCAACCGCAACATCGACAACTTCTTCGCGGAGAACGAGCAGCTGGCCTTCTGCCCGGGCCTCATC
GTCCCTGGTATCTACTACTCCGACGACAAGCTGCTGCAGACCAGGATCTTCTCCTACTCCGACACGCAGCGCCACCGCCTCGGCCCCAACTACCTGCTGCTACCGGCCAACGCGCCCAAG
TGCGCACACCACAACAACCACTACGACGGATCCATGAACTTCATGCACCGCCACGAGGAGGTCGACTACTTCCCCTCCAGGTACGACGCCGTCAGGAACGCGCCGAGGTACCCGATCCCG
ACCGCCCACATCGCCGGCCGCCGAGAGAAG
GTACTGCATGCATATCATCAATCAATCACCCTGTCGATCATCGTCATCGATCGATAGTAATAAGTAGCCGCTCATCATCGATCACCTGTC
CTGTCCGTCGTTGCTGCAGACTGTGATTAGCAAGGAGAACAACTTCAAGCAGCCCGGGGAGAGGTACCGCGCGATGGACCCAGCAAGGTGCGTGCAGTGGCGCCGTCATCCCAATTCCTT
CCTTTCTTTGCCTTTTCAACTGGACTGAACTGGACTGTACTGCAGGCAAGAGCGGTTCATAACCAGATGGGTCGACGCGCTCTCCGACCCCCGCCTCACCCACGAGATCAGGACCATCTG
GCTCTCCAACTGGTCTCAG
GTAGGTGTAGGTGACAACCCGCAGCTTAATTATTCAGGCGATGATGTCATTTGCTCGCTGAACTGAACGAGCTGCACTCTGAATCGCGCTGGTTGCCTCGT
CCATGGATGCAGGCCGACAGGTCTCTGGGCCAGAAGCTCGCGAGCCGCCTCAGCGCCAAGCCGAGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCGTACAAGCACCGCCCGTCGAGCGCCTTCAACGCCCCGTACTGGACCACCAACTCCGGCGCCCCCGTGTGGAACAACGACAGCTCCCTCACCGTCGGCGCACGAGGTCCCATC
CTGCTGGAGGACTACCACCTGGTGGAGAAGCTAGCCAACTTCGACCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGTGGCGCCAGCGCCAAGGGCTTCTTCGAGGTGACCCACGAC
ATCACCCACCTGACGTGCGCCGACTTCCTGCGCGCGCCCGGGGTGCAGACGCCCGTCATCGTCCGCTTCTCCACGGTGATCCACGAGCGCGGGAGCCCCGAGACGCTGCGCGACCCGCGC
GGGTTCGCCGTCAAGTTCTACACCCGGGAGGGCAACTGGGACCTGGTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCGGACATGGTGCACGCGCTCAAGCCC
AACCCGCGGACGCACATCCAGGACAACTGGCGCATCCTCGACTTCTTCTCGCACCACCCGGAGAGCCTGCACATGTTCTCCTTCCTCTTCGACGACGTCGGCATCCCCGCCGACTACCGC
CACATGGACGGATCCGGGGTGCACACGTACACGCTCGTCAGCCGCGCCGGCACCGTCACCTACGTCAAGTTCCACTGGCGCCCCACCTGCGGCGTGCGCTCGCTGATGGACGACGAGGCC
GTCGCCGTTGGCGGCGCCAACCACAGCCACGCCACCAAGGACCTCACGGACGCCATCGCGGCGGGGAACTTCCCCGAGTGGACGCTCTACATCCAGACCATGGACCCCGAGATGGAAGAC
CGCCTCGACGACCTGGACCCGCTGGACGTGACCAAGACGTGGCCCGAGGACGCGTTCCCGCTGCAGCCCGTGGGCCGCCTGGTGCTCAACCGCAACATCGACAACTTCTTCGCGGAGAAC
GAGCAGCTGGCCTTCTGCCCGGGCCTCATCGTCCCTGGTATCTACTACTCCGACGACAAGCTGCTGCAGACCAGGATCTTCTCCTACTCCGACACGCAGCGCCACCGCCTCGGCCCCAAC
TACCTGCTGCTACCGGCCAACGCGCCCAAGTGCGCACACCACAACAACCACTACGACGGATCCATGAACTTCATGCACCGCCACGAGGAGGTCGACTACTTCCCCTCCAGGTACGACGCC
GTCAGGAACGCGCCGAGGTACCCGATCCCGACCGCCCACATCGCCGGCCGCCGAGAGAAG
ACTGTGATTAGCAAGGAGAACAACTTCAAGCAGCCCGGGGAGAGGTACCGCGCGATGGAC
CCAGCAAG
GCAAGAGCGGTTCATAACCAGATGGGTCGACGCGCTCTCCGACCCCCGCCTCACCCACGAGATCAGGACCATCTGGCTCTCCAACTGGTCTCAGGCCGACAGGTCTCTGGGC
CAGAAGCTCGCGAGCCGCCTCAGCGCCAAGCCGAGCATGTAA

Retrieve as FASTA