Entry information : ZmKat3 (cat3 / GRMZM2G079348 [6a])
Entry ID 6439
Creation 2008-12-24 (Cyril Jourda)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmKat3 (cat3 / GRMZM2G079348 [6a])
Name (synonym) ZmKat3 (cat3 / GRMZM2G079348 [6a])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Mitochondria
Tissue type Silks
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmKat3
start..stop
S start..stop
SpKat01 987 0 2..495 1..493
SbKat01 986 0 2..495 1..493
OsKat01 905 0 2..495 1..492
CclKat01 791 0 2..495 1..493
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 240105134..240105151 18 N° 2 240105263..240106672 1410 N° 3 240106766..240106825 60  
join(240105134..240105151,240105263..240106672,240106766..240106825)


exon

Literature and cross-references ZmKat3 (cat3 / GRMZM2G079348 [6a])
Literature REFERENCE 1 Abler M.L., Scandalios J.G. Isolation and characterization of a genomic sequence encoding the maize Cat3 catalase gene.Plant Mol. Biol. 22:1031-1038(1993)
REFERENCE 2 Redinbaugh M.G., Wadsworth G.J., Scandalios J.G. Characterization of catalase transcripts and their differential expression in maize. Biochim. Biophys. Acta 951:104-116(1988)
Protein ref. UniProtKB:   P18123
mRNA ref. GenBank:   M33103
Cluster/Prediction ref. UniGene:   Zm.4508
Protein sequence: ZmKat3 (cat3 / GRMZM2G079348 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   495
PWM (Da):   %s   56512.15  
PI (pH):   %s   6.96
Sequence 536
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TMDPTKFRPSSSHDTTVTTTNAGAPVWNDNEALTVGPRGPILLEDYHLIEKVAHFARERIPERVVHARGASAKGFFECTHDVTSLTCADFLRAPGVRTPVIVRFSTVIHERGSPETIRDPRGFAVKFYTREGNWDLLGNNFPVFFIRDGIKFPDVIHAFKPNPRSHVQEYWRVFDFLSHLPESLHTFFFLFDDVGVPSDYRHMEGFGVNTYTFVSAAGKAQYVKFHWKPTCGVRCILTDEEAALVGGRNHSHATQDLYDSIAAGSFPEWTLYVQVMEPDTEEQYDFDPLDDTKTWPEDLLPLRPVGRLVLDRNVDNFFNENEQLAFGPGLVVPGIYYSDDKMLQCRVFAYADTQRYRLGPNYLMLPVNAPRCAHHNNHYDGAMNFMHRDEEVDYYPSRHAPLRQAAPPTPLPPRPVAGRREKATIRKPNDFKQPGERYRSWDADRQDRFVRRFADSLGHPKVSQELRSIWIDLLAKCDASLGMKIATRLNMKANM

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns), 5 mRNA and 131 ESTs. Cultivar="W64A". last short exon is not predicted by Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAATGGATCCTACCAAGGTGAGCTCAGTATACTCTGCTTCTTCTTCTTCCGTCATATCGATCTTTGATTTGAGATTCGTAGCTCAGTACCTGTTTTGTGTTGTTTACTTGTGTTGATTTT
GCTTGCAGTTCCGTCCGTCCAGCAGCCACGACACGACGGTGACGACGACGAACGCGGGCGCTCCTGTGTGGAACGACAACGAGGCGCTGACTGTGGGGCCTCGCGGTCCCATCCTGCTGG
AGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCGCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGCGGGGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGACGTGACGT
CGCTGACGTGCGCCGACTTCCTGCGCGCGCCCGGCGTGCGGACGCCCGTGATCGTGCGCTTCTCGACGGTGATCCACGAGCGGGGGTCCCCGGAGACGATCCGCGACCCGCGCGGGTTCG
CCGTGAAGTTCTACACCCGCGAGGGCAACTGGGACCTGCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCCGACGTGATCCACGCGTTCAAGCCCAACCCGC
GGTCGCACGTGCAGGAGTACTGGCGGGTGTTCGACTTCCTGTCGCACCTCCCCGAGAGCCTGCACACCTTCTTCTTCCTCTTCGACGACGTGGGCGTGCCGTCCGACTACCGCCACATGG
AAGGGTTCGGCGTGAACACGTACACGTTCGTGAGCGCGGCGGGGAAGGCGCAGTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTGCGGTGCATCCTGACGGACGAGGAGGCGGCGC
TGGTCGGGGGACGGAACCACAGCCACGCGACGCAGGACCTGTACGACTCCATCGCGGCGGGGAGCTTCCCGGAGTGGACGCTGTACGTGCAGGTGATGGAGCCGGACACGGAGGAGCAGT
ACGACTTCGACCCGCTGGACGACACCAAGACGTGGCCGGAGGACCTGCTGCCGCTCCGCCCCGTGGGGAGGCTGGTGCTGGACAGGAACGTGGACAACTTCTTCAACGAGAACGAGCAGC
TGGCGTTCGGCCCGGGGCTGGTGGTGCCAGGGATCTACTACTCGGACGACAAGATGCTGCAGTGCCGGGTGTTCGCCTACGCCGACACGCAGCGCTACAGGCTGGGTCCCAACTACCTGA
TGCTGCCCGTCAACGCGCCGCGCTGCGCGCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCGCCGCTGCGGC
AGGCGGCGCCGCCCACGCCACTGCCGCCCAGGCCGGTCGCGGGGAGGAGGGAGAAGGCAACCATACGCAAGCCCAACGACTTCAAGCAGCCAGGGGAGAGGTACCGCTCCTGGGACGCCG
ACCGACAGGACCGATTCGTGAGGCGATTCGCCGACTCGCTCGGACACCCAAAGGTCAGCCAGGAGCTCAGGTCCATCTGGATAGACCTCCTCGCCAAG
GTACGTGGATGGCATGGCATGG
CAGTGCCACACGTGTTTTCGATCGATCTAGCTACTCATGCATGATATACGACGATTGCTTTGCATATGCAGTGCGACGCGTCGCTGGGGATGAAGATTGCCACCCGGCTCAACATGAAGG
CAAACATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAATGGATCCTACCAAGTTCCGTCCGTCCAGCAGCCACGACACGACGGTGACGACGACGAACGCGGGCGCTCCTGTGTGGAACGACAACGAGGCGCTGACTGTGGGGCCTCGCGGTCCCA
TCCTGCTGGAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCGCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGCGGGGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACG
ACGTGACGTCGCTGACGTGCGCCGACTTCCTGCGCGCGCCCGGCGTGCGGACGCCCGTGATCGTGCGCTTCTCGACGGTGATCCACGAGCGGGGGTCCCCGGAGACGATCCGCGACCCGC
GCGGGTTCGCCGTGAAGTTCTACACCCGCGAGGGCAACTGGGACCTGCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCCGACGTGATCCACGCGTTCAAGC
CCAACCCGCGGTCGCACGTGCAGGAGTACTGGCGGGTGTTCGACTTCCTGTCGCACCTCCCCGAGAGCCTGCACACCTTCTTCTTCCTCTTCGACGACGTGGGCGTGCCGTCCGACTACC
GCCACATGGAAGGGTTCGGCGTGAACACGTACACGTTCGTGAGCGCGGCGGGGAAGGCGCAGTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTGCGGTGCATCCTGACGGACGAGG
AGGCGGCGCTGGTCGGGGGACGGAACCACAGCCACGCGACGCAGGACCTGTACGACTCCATCGCGGCGGGGAGCTTCCCGGAGTGGACGCTGTACGTGCAGGTGATGGAGCCGGACACGG
AGGAGCAGTACGACTTCGACCCGCTGGACGACACCAAGACGTGGCCGGAGGACCTGCTGCCGCTCCGCCCCGTGGGGAGGCTGGTGCTGGACAGGAACGTGGACAACTTCTTCAACGAGA
ACGAGCAGCTGGCGTTCGGCCCGGGGCTGGTGGTGCCAGGGATCTACTACTCGGACGACAAGATGCTGCAGTGCCGGGTGTTCGCCTACGCCGACACGCAGCGCTACAGGCTGGGTCCCA
ACTACCTGATGCTGCCCGTCAACGCGCCGCGCTGCGCGCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCGC
CGCTGCGGCAGGCGGCGCCGCCCACGCCACTGCCGCCCAGGCCGGTCGCGGGGAGGAGGGAGAAGGCAACCATACGCAAGCCCAACGACTTCAAGCAGCCAGGGGAGAGGTACCGCTCCT
GGGACGCCGACCGACAGGACCGATTCGTGAGGCGATTCGCCGACTCGCTCGGACACCCAAAGGTCAGCCAGGAGCTCAGGTCCATCTGGATAGACCTCCTCGCCAAG
TGCGACGCGTCGC
TGGGGATGAAGATTGCCACCCGGCTCAACATGAAGGCAAACATGTGA

Retrieve as FASTA