Entry information : ZmPrx103 (GRMZM2G451097 [6a])
Entry ID 6470
Creation 2009-03-24 (Christophe Dunand)
Last sequence changes 2015-07-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-07-02 (Christophe Dunand)
Peroxidase information: ZmPrx103 (GRMZM2G451097 [6a])
Name (synonym) ZmPrx103 (GRMZM2G451097 [6a])
Class Class III peroxidase     [Orthogroup: Prx069]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx103
start..stop
S start..stop
SbPrx41 516 2e-178 267..560 326..618
SiPrx115 490 3e-173 267..560 1..292
OsPrx106-1 377 3e-127 264..560 90..384
ZmPrx63 375 5e-127 265..560 52..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 169032179..169032353 175 N° 2 169031289..169032041 753  
complement(join(169031289..169032041,169032179..169032353))


exon

Literature and cross-references ZmPrx103 (GRMZM2G451097 [6a])
DNA ref. GenBank:   AC186568.4 (47732..49997)
Protein sequence: ZmPrx103 (GRMZM2G451097 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   561 (533)
PWM (Da):   %s   57226.13 (54473.6) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.88 (4.99) Peptide Signal:   %s   cut: 28 range:28-560
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPPPELAVVVPTMTLLVLALLGAAVAGKISYAPSTSPPATTPTSPNQSPPTYHAPSQIPSSTSITPPSPSPKLSLLLPTNSQPIPSPISYPPSQSPSISNPPANSQPIPNTSPSSISPTYPPSGRSSNPLISGPPIYPPSGSSNPSISSPPTYPQGVSTNPLVSNSPTYPQSASPSPSISTPPTYAPSASPSSSISTPPIYAPSTSPSSSISTPPIYPPSPSPSLSINSPPGSPTPSPSSSISIPPTYPPSLSPSPSSAPSSGLSVGYYKHTCSGAETIVREVVTNAIDSNRGTGAGLIRLFFHDCFVQGCDASVLLNTTGSSEPTERASAPNLSLRGFDVIDAAKAALEAACPGVVSCADIVAFAGRDATCILSGSAVSFDMPAGRHDGRVSLDSEAVANLPPPFASLERLEEMFAAKGLDVEDMVTLSGAHTVGRSHCSSFSDRLPPHVSDMNDTLSGTLATQCNSGGGGDTTVPQDSVTPGGLDSQYYRNVLNHEVLFASDAALLASDQTADMVSANAFTPGLWETKFKAAMVKMGRVGIKTSTDGEIRDKCWMVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1). No EST. Very long PS also found in orthologs from other monocotyledons.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTAAGCCCAAGCCCAAGTAGTGCTCCTTCGTCAGGGCTTAGTGTCGGCTACTACAAGCATACATGCTCTGGAGCGGAGACTATTGTGAGGGAGGTTGTGACGAATGCCATAGACAGCAA
TCGTGGCACGGGCGCGGGGCTCATTCGTTTGTTCTTCCATGACTGCTTCGTTCAG
GTAATTACCATTGCGGCTGATCGATCTTCTCTTCACCTTCAATGGGGGCTAACTATCAGTTAATG
GCTCGGGTACCATACCAAATGATACGAATATGCTGCATGAATAATGCATGTACTGATTTGACGGTCATTCAGGGGTGCGACGCTTCTGTTCTCCTGAACACGACCGGCTCCAGCGAGCCG
ACGGAGAGAGCCAGCGCACCCAACCTGAGCCTGCGCGGCTTCGATGTGATCGACGCGGCCAAGGCGGCGCTCGAGGCTGCCTGCCCCGGCGTCGTCTCGTGCGCGGACATCGTCGCCTTC
GCCGGCCGCGACGCCACCTGCATCCTCAGCGGCAGCGCGGTCAGCTTCGACATGCCGGCCGGCCGCCACGACGGCCGCGTGTCCCTCGACAGCGAGGCCGTCGCCAACCTGCCGCCGCCG
TTCGCCAGCCTCGAGAGGCTCGAGGAGATGTTCGCCGCCAAGGGGCTCGACGTCGAGGACATGGTGACGCTCTCCGGCGCCCACACCGTCGGCCGCTCCCACTGCTCCTCCTTCTCCGAC
CGCCTCCCGCCCCACGTCTCGGACATGAACGACACGCTCTCCGGCACGCTGGCCACGCAGTGCAACAGCGGCGGCGGCGGCGACACCACGGTGCCGCAGGACTCGGTGACCCCCGGCGGC
CTGGACAGCCAGTACTACAGGAACGTGCTCAACCACGAGGTGCTCTTCGCGTCGGACGCCGCGCTGCTGGCGTCGGACCAGACGGCGGACATGGTGTCCGCCAACGCGTTCACGCCGGGG
CTGTGGGAGACCAAGTTTAAGGCGGCGATGGTGAAGATGGGCCGCGTCGGAATCAAGACCAGCACCGACGGTGAGATCAGAGACAAGTGCTGGATGGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTAAGCCCAAGCCCAAGTAGTGCTCCTTCGTCAGGGCTTAGTGTCGGCTACTACAAGCATACATGCTCTGGAGCGGAGACTATTGTGAGGGAGGTTGTGACGAATGCCATAGACAGCAA
TCGTGGCACGGGCGCGGGGCTCATTCGTTTGTTCTTCCATGACTGCTTCGTTCAG
GGGTGCGACGCTTCTGTTCTCCTGAACACGACCGGCTCCAGCGAGCCGACGGAGAGAGCCAGCGC
ACCCAACCTGAGCCTGCGCGGCTTCGATGTGATCGACGCGGCCAAGGCGGCGCTCGAGGCTGCCTGCCCCGGCGTCGTCTCGTGCGCGGACATCGTCGCCTTCGCCGGCCGCGACGCCAC
CTGCATCCTCAGCGGCAGCGCGGTCAGCTTCGACATGCCGGCCGGCCGCCACGACGGCCGCGTGTCCCTCGACAGCGAGGCCGTCGCCAACCTGCCGCCGCCGTTCGCCAGCCTCGAGAG
GCTCGAGGAGATGTTCGCCGCCAAGGGGCTCGACGTCGAGGACATGGTGACGCTCTCCGGCGCCCACACCGTCGGCCGCTCCCACTGCTCCTCCTTCTCCGACCGCCTCCCGCCCCACGT
CTCGGACATGAACGACACGCTCTCCGGCACGCTGGCCACGCAGTGCAACAGCGGCGGCGGCGGCGACACCACGGTGCCGCAGGACTCGGTGACCCCCGGCGGCCTGGACAGCCAGTACTA
CAGGAACGTGCTCAACCACGAGGTGCTCTTCGCGTCGGACGCCGCGCTGCTGGCGTCGGACCAGACGGCGGACATGGTGTCCGCCAACGCGTTCACGCCGGGGCTGTGGGAGACCAAGTT
TAAGGCGGCGATGGTGAAGATGGGCCGCGTCGGAATCAAGACCAGCACCGACGGTGAGATCAGAGACAAGTGCTGGATGGTCAACTAA

Retrieve as FASTA