Entry information : PinvHalPrx01
Entry ID 6504
Creation 2009-01-20 (Christophe Dunand)
Last sequence changes 2012-04-13 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-13 (Christophe Dunand)
Peroxidase information: PinvHalPrx01
Name PinvHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvHalPrx01
start..stop
S start..stop
PinvHalPrx02 534 0 1..291 1..291
SlutHalPrx05 448 5e-161 1..286 1..286
SbreHalPrx05 434 1e-155 1..273 1..273
SbreHalPrx01 397 4e-141 1..279 1..279
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 500531..500753 223 N° 2 500815..501018 204 N° 3 501077..501290 214 N° 4 501346..501580 235
join(500531..500753,500815..501018,501077..501290,501346..501580)


exon

Literature and cross-references PinvHalPrx01
Literature Stephen,S.A., Caillau,M., Wright,D.P., Johansson,T., Tunlid,A., Soderstrom,B., Read,D.J. and Scholes,J.D. Transcriptional programmes for nutrient acquisition by the ectomycorrhizal fungus Paxillus involutus.
DNA ref. JGI genome:   scaffold_11 (500531..501580)
EST ref. GenBank:   EW970255.1 [5' end]
Cluster/Prediction ref. JGI gene:   168545
Protein sequence: PinvHalPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   292
PWM (Da):   %s   32454.26  
PI (pH):   %s   6.51
Sequence 333
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLLSSVSNVFYDASVMTWDVFLTLANLVRFSRPVGKVTPEGHPGYGGYWPEYIPPREGDSRCSCPAINAMANHGILPRNGKAITFIELNHQIRSTFNFGASFCSFVPHYAARMLNKSYSNDTFDLEELDLHNGIEHDGSLTRLDTALSPNQSSPHVPFIEDLLTFASGKDAEGRDLFTIKDMSRILGKRRAEARATNKDFTTSLFHKVFGSANSSTLLTIFGGRLDDLRTLLLEERLPQGWESRVRKPYGLTMLTFNWTVLPVEFGIRESDWASDAKQDAKAIQSDGEGA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs (EW974317). 3'end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCTTCTCAGCTCTGTCTCTAACGTTTTTTATGATGCCAGCGTTATGACCTGGGACGTCTTCCTTACGCTGGCTAACCTCGTACGATTCAGCCGTCCTGTTGGAAAAGTTACGCCCG
AGGGCCATCCAGGTTATGGTGGATACTGGCCAGAGTACATACCACCTCGAGAGGGTGATAGTAGATGTTCCTGCCCAGCTATCAACGCAATGGCCAACCACG
GTAAGTTCGCAATTTTGC
AAGATCTGTGGCGATCATCGGTAAACTGATTTTATTCTGTTAGGAATCCTTCCGCGCAATGGCAAGGCAATCACGTTCATTGAACTTAACCATCAGATCCGCTCGACGTTCAACTTTGGG
GCTTCATTCTGCTCTTTTGTGCCGCACTATGCCGCGCGCATGCTGAACAAGAGCTATAGCAACGACACATTTGACTTGGAGGAACTCGACTTGCACAATGGCATTGAACACGATGGATCG
CTCACCC
GTACGTCATTCGCCCGCGGTTCTACGGGACTCAGTCTTGATTCTTTGCTCGATTCTAGGACTTGACACAGCGCTGTCGCCCAACCAATCATCGCCACATGTCCCCTTCATCGA
AGATCTGCTCACTTTCGCCAGTGGCAAAGATGCGGAGGGGAGAGATCTATTCACCATCAAAGACATGTCCCGAATTCTCGGCAAGCGCCGAGCAGAGGCAAGGGCAACTAACAAGGACTT
CACCACGAGCCTATTCCACAAGGTGTTCGGTAGTGCTAA
GTATGTTCTTTCACTACTGGATTTTTTTTTACGACTGAAGGCTTCATTGGGGTAGTTCATCGACCTTGCTCACCATCTTCG
GTGGTCGATTGGATGATCTGCGGACGCTTCTTCTCGAGGAGCGATTGCCTCAAGGCTGGGAATCCCGCGTTCGCAAGCCCTATGGGCTGACCATGCTCACGTTCAACTGGACTGTCCTTC
CAGTGGAATTCGGCATTCGAGAGTCTGATTGGGCATCAGATGCGAAACAGGATGCCAAGGCGATCCAGAGTGACGGCGAAGGCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCTTCTCAGCTCTGTCTCTAACGTTTTTTATGATGCCAGCGTTATGACCTGGGACGTCTTCCTTACGCTGGCTAACCTCGTACGATTCAGCCGTCCTGTTGGAAAAGTTACGCCCG
AGGGCCATCCAGGTTATGGTGGATACTGGCCAGAGTACATACCACCTCGAGAGGGTGATAGTAGATGTTCCTGCCCAGCTATCAACGCAATGGCCAACCACG
GAATCCTTCCGCGCAATG
GCAAGGCAATCACGTTCATTGAACTTAACCATCAGATCCGCTCGACGTTCAACTTTGGGGCTTCATTCTGCTCTTTTGTGCCGCACTATGCCGCGCGCATGCTGAACAAGAGCTATAGCA
ACGACACATTTGACTTGGAGGAACTCGACTTGCACAATGGCATTGAACACGATGGATCGCTCACCC
GACTTGACACAGCGCTGTCGCCCAACCAATCATCGCCACATGTCCCCTTCATCG
AAGATCTGCTCACTTTCGCCAGTGGCAAAGATGCGGAGGGGAGAGATCTATTCACCATCAAAGACATGTCCCGAATTCTCGGCAAGCGCCGAGCAGAGGCAAGGGCAACTAACAAGGACT
TCACCACGAGCCTATTCCACAAGGTGTTCGGTAGTGCTAA
TTCATCGACCTTGCTCACCATCTTCGGTGGTCGATTGGATGATCTGCGGACGCTTCTTCTCGAGGAGCGATTGCCTCAAG
GCTGGGAATCCCGCGTTCGCAAGCCCTATGGGCTGACCATGCTCACGTTCAACTGGACTGTCCTTCCAGTGGAATTCGGCATTCGAGAGTCTGATTGGGCATCAGATGCGAAACAGGATG
CCAAGGCGATCCAGAGTGACGGCGAAGGCGCCTGA

Retrieve as FASTA