Entry information : LePrx54 (Solyc11g072920.1.1[2.3])
Entry ID 652
Creation 2005-09-15 (Christophe Dunand)
Last sequence changes 2014-08-27 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-10-06 (Achraf Jemmat)
Peroxidase information: LePrx54 (Solyc11g072920.1.1[2.3])
Name (synonym) LePrx54 (Solyc11g072920.1.1[2.3])
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Solanum
Organism Lycopersicon esculentum (Tomato)    [TaxId: 4081 ]
Cellular localisation N/D
Tissue types Callus
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LePrx54
start..stop
S start..stop
NtPrx04-1A 581 0 1..321 1..323
PpePrx07 508 0 19..327 22..331
GhPrx22 503 0 22..327 26..331
MePrx53 502 0 7..327 12..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53160813..53161025 213 N° 2 53160522..53160719 198 N° 3 53160197..53160362 166 N° 4 53159700..53160106 407
complement(join(53159700..53160106,53160197..53160362,53160522..53160719,5316081 3..53161025))


exon

Literature and cross-references LePrx54 (Solyc11g072920.1.1[2.3])
Literature Alcala,J. et al., unpublished
EST ref. GenBank:   AW216691 [3' end]
Cluster/Prediction ref. UniGene:   Les.24835 [5' end]
Protein sequence: LePrx54 (Solyc11g072920.1.1[2.3])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   34814.03 (32024.7)  
PI (pH):   %s   4.65 (4.76) Peptide Signal:   %s   cut: 25 range:25-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPNYILVVICILLSTCSFYETNAQLSANFYSTTCPNVSSIVQNVIQQALQSDARIGASLIRLHFHDCFVNGCDASLLLDNNATTNIVSEKDAAPNTNSTRGFDVVDNIKTALESSCPGVVSCADILALAAESSVSLAGGPSWNVLLGRRDSRTANQAGANTSIPSPTEGLTNITAKFTAVGLNLTDLVALSGAHTFGRAQCRVFSARLYNFNGTGNPDPSLNTTYLSNLRQICPQNGSATALANLDPTTSDGFDNNYFANLQNNQGLLQSDQELFSSATTLSIVNTFSSNQNTFFQSFVQSMINMGNISPLTGTNGEIHLDCKRIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 11, 3 introns) and 5 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAAATCTAG AGGAATTAAA AAATACAAAA AAGAACATTT TTAATAGTTT AATTCTTATA AATATGTTAG AGTTGTTAAT TATCATGGCT TTTTACGTAA TTTTCAAATA TGTAAATTTT  ATTTTAATTT AAAATAAAAT AAAAAAATTT AACGTCTAAA TTTATAATTT AAAATTGACT CCCGAAGTAA TTAGGTAGCA CTTCTCTGGA TATTATAAGG ATTTGGTGAA AGTAGTTGGG  AGTAAAATTG TTTTCTTTGG CTATCGATAG CCCCAATAAT CACCTAATCA AAGCAATCGT ATAAAAGACA GATTATTAAT TTGTCATTTT ATCAAACAAC AATTATTTGC AAATATATTG  ACTCACTGAG ATTGTCATTT TTTAAAAAAA GGAAGATATA TATCAAAATA ATGTCAAAAT TATTTATTGG AATTTTATCT AAAAATTTAT AATATACACT TATAAATTTT ACTGTTTGAT  CTCAATCTAA TATTCCTTCT CCTTTCACCA TAGGTGAAAT TTTTTGGTTA ATTTTTTTTC TAATTGTCTA ACTAACGGGT ATTTTAAATC AATTATTTTT ATAATAATAA TCATGATAAG  TAAAATAGAC GAAAGGGAGT ATGTCCTTTA TATTATTAAA ACTTGTATCA AAAGAGACAT TATATTTGAA GCAAATAGAT GTGCAATAGT TTTAAAATTT TGAATACAAA TTAAATAATA  ATGTCCAAAT AAAAAAAACC TAATCACTAC TTGAAAATGT AGTTATTGAA ATTGGAAAAG GGAATTTATG ATTACTAAAA TTGAATACAG CAACATATTG CCCACATTCT AATTTTTTCC  TTAAATAATG GAGAATCTTT GAAAATTTAC TATCGAAAAT GTTAAATCAA CTTTAATGAT TTATATTAAT CAGTCACAAC TTGCATCCAT TATTGCAGAA GGTTCTCTAA TGAGAAAAGT  GTCTGAATTT CAAGAGGATA CAAATTCGGT TTTATCATAG TTTTTAAATA TATTTTGAAT AAAGAAGTAT TACGACTTGT ACTACTTTTT AGGTAGGTTT TAAATATGTA TAATATATTT  TAAATATTTA AAGATTTTAT ATTAAAATTC ATGATAAAAA TAAAATTATT TGACTCTCAA AATTTAAACG ATATCAAATA GATTGAGACA TAGATAGATA TATAAAAATT ATCGATTACT  TGTTACATAA GATTTTGATT TAATAAGAAA TCACCGGAAT TTTTAATATT TTATTCAAAT ATTGAAAAAG TCTCATATGA CTACTTCTTT CCCCATTTTG CCTTGGACTA TTTTCCACAA  AAGTCTGCTG TAATAGACTA GTAACACAAA TTCCCTAATT GGTGGAGTGG AATACATCTA CCCCCTTAAA TTTGTTATTT AAAAAAAATA TTGAATTATA TAGTCATTAT ATCAAATTAT  CGATAGATGA AATTTTAATA ACAAATAAAA AGTTGGGATA AAAATATGCA TTATATATAT ATATTAAGAT ATAGCAAGAG AAAAATACAC AATTGGAACA GATATATCAT CGCATGTGAT  TATGTAATAA CTAATATAGT AAACAAATAC TCATTTGGAA GATAACTTTT TATTTTTTTA ATACTCACGC TTTGTTACGT CAACGTCAAC GTTAAAGGAG ACAAAGAGCG AATTTTTAAA  TTTTCTATCG TCAACATTCA GAAATAAATC GTTTTATATA ATCAAATTCA AGGATAATTA AAATTAAAAA TAATAATTCG AGCCAAGTTT AGAAACTTTT TTAAGTATCT CGTGTTGCTC  ATTTCACCAA ACACACTTAC AAATAAAGAA AATTATTTTG TTTGACTATG TTCTAGGAAA TTGTCAATGA TACTACATGA AGAGAAGACA CTTTTTGGTT CTTTATATAT TGCCTAGATC 
TATCGCTAAT TCATGAAACA CGAGTGTAAA AGAAATTTCT TTTCTATCTA ATATAATAAA AATAAATACC AAGAGAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCTAATTATATTTTAGTAGTTATATGCATTTTGTTATCAACTTGTAGTTTCTATGAAACAAATGCCCAATTGAGTGCTAATTTTTACTCAACTACATGTCCTAATGTTTCAAGT
ATAGTCCAAAATGTAATTCAACAAGCTTTACAGTCCGATGCACGTATTGGAGCCAGCCTCATCCGTCTTCATTTTCATGATTGCTTTGTCAAC
GTAAATTTACTCTTTCTTATTACATTT
TTACACATAATTTGTATTGCTCGTTAGCTCATTTTAAGTGACATGATTCTACTTGTTATATCACAGGGATGTGATGCTTCACTTTTGTTAGATAACAACGCTACAACAAATATAGTAAGT
GAGAAAGATGCAGCTCCAAACACAAATTCCACAAGAGGTTTCGACGTCGTTGACAACATTAAAACAGCTCTTGAAAGTTCTTGCCCTGGCGTTGTCTCTTGTGCTGATATTCTTGCTCTT
GCTGCAGAATCCTCTGTTTCTCTG
GTACGAAAAGAATGTCACATTTCTATAATTAAAAACAATTCAACTTATAAAATTTTCCTTTTACCTTTATTGAAATGATATACAAACACAAAAATG
ATTTAGACCCGATTTTTTTTCTTCAAAAATCTTCTTTTTTTTGTTAAACTTTATTTCGTGCAGGCAGGTGGTCCTTCATGGAATGTTTTATTAGGACGAAGAGACAGTAGAACCGCAAAC
CAGGCTGGAGCTAATACATCAATTCCTTCTCCAACCGAAGGATTAACCAACATTACAGCAAAGTTTACTGCTGTTGGCCTTAATCTTACTGATTTAGTTGCCTTATCTG
GTAATTAATCA
ATTAGCTCTGTTTTGATTGCATATCCATTTGGGAAGTCGAACGATTTACTAATTAATTTCGATAAATCTTTGTTATTAGGTGCACATACATTTGGACGTGCCCAATGTCGTGTATTCAGT
GCCAGGCTTTACAATTTCAATGGCACAGGAAATCCAGATCCGAGTTTAAACACAACTTATCTGTCAAACCTTAGGCAAATATGTCCTCAAAATGGCAGTGCAACAGCGTTGGCTAATCTT
GACCCAACCACATCTGATGGTTTTGATAATAATTATTTCGCGAATTTGCAGAACAATCAAGGGCTTTTGCAATCCGATCAAGAGTTATTCTCATCAGCAACAACTTTATCGATTGTGAAC
ACATTTAGTAGTAACCAAAATACATTTTTTCAGAGCTTTGTTCAGTCTATGATTAATATGGGAAATATTAGTCCGTTAACGGGTACCAATGGGGAGATTCACTTAGATTGTAAAAGAATC
AATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCTAATTATATTTTAGTAGTTATATGCATTTTGTTATCAACTTGTAGTTTCTATGAAACAAATGCCCAATTGAGTGCTAATTTTTACTCAACTACATGTCCTAATGTTTCAAGT
ATAGTCCAAAATGTAATTCAACAAGCTTTACAGTCCGATGCACGTATTGGAGCCAGCCTCATCCGTCTTCATTTTCATGATTGCTTTGTCAAC
GGATGTGATGCTTCACTTTTGTTAGAT
AACAACGCTACAACAAATATAGTAAGTGAGAAAGATGCAGCTCCAAACACAAATTCCACAAGAGGTTTCGACGTCGTTGACAACATTAAAACAGCTCTTGAAAGTTCTTGCCCTGGCGTT
GTCTCTTGTGCTGATATTCTTGCTCTTGCTGCAGAATCCTCTGTTTCTCTG
GCAGGTGGTCCTTCATGGAATGTTTTATTAGGACGAAGAGACAGTAGAACCGCAAACCAGGCTGGAGCT
AATACATCAATTCCTTCTCCAACCGAAGGATTAACCAACATTACAGCAAAGTTTACTGCTGTTGGCCTTAATCTTACTGATTTAGTTGCCTTATCTG
GTGCACATACATTTGGACGTGCC
CAATGTCGTGTATTCAGTGCCAGGCTTTACAATTTCAATGGCACAGGAAATCCAGATCCGAGTTTAAACACAACTTATCTGTCAAACCTTAGGCAAATATGTCCTCAAAATGGCAGTGCA
ACAGCGTTGGCTAATCTTGACCCAACCACATCTGATGGTTTTGATAATAATTATTTCGCGAATTTGCAGAACAATCAAGGGCTTTTGCAATCCGATCAAGAGTTATTCTCATCAGCAACA
ACTTTATCGATTGTGAACACATTTAGTAGTAACCAAAATACATTTTTTCAGAGCTTTGTTCAGTCTATGATTAATATGGGAAATATTAGTCCGTTAACGGGTACCAATGGGGAGATTCAC
TTAGATTGTAAAAGAATCAATTGA

Retrieve as FASTA