Entry information : CcinKat01
Entry ID 6530
Creation 2009-01-30 (Christophe Dunand)
Last sequence changes 2010-08-13 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-22 (Christophe Dunand)
Peroxidase information: CcinKat01
Name CcinKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinKat01
start..stop
S start..stop
LbiKat01 904 0 1..521 1..521
PscKat01 852 0 1..520 1..521
AbKat01_bisporus 845 0 14..520 8..514
SlutKat01 817 0 1..520 1..520
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1247765..1247888 124 N° 2 1247649..1247707 59 N° 3 1247453..1247594 142 N° 4 1247211..1247398 188
N° 5 1246969..1247148 180 N° 6 1246799..1246912 114 N° 7 1246650..1246746 97 N° 8 1246433..1246591 159
N° 9 1246285..1246374 90 N° 10 1246079..1246231 153 N° 11 1245896..1246021 126 N° 12 1245671..1245828 158
complement(join(1245671..1245828,1245896..1246021,1246079..1246231,1246285..1246 374,1246433..1246591,1246650..1246746,1246799..1246912,1246969..1247148,1247211. .1247398,1247453..1247594,1247649..1247707,1247765..1247888))


exon

Literature and cross-references CcinKat01
DNA ref. JGI genome:   Chr_12 (1247888..1245674)
mRNA ref. GenBank:   XM_001834983
Cluster/Prediction ref. Genebank:   6011556
Protein sequence: CcinKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   529
PWM (Da):   %s   59536.93  
PI (pH):   %s   6.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSAQVWNTKDGAVYTTSNGAPVNEPYAAQRAGINGPLLLQDFHHIDLLAHFDRERIPERVHAKGAGAHGYFETTHSLSDITSIPLFQKPGTKVRATVRFSTVGGESGSADTARDPRGFAIKLRTEDGNWDWVFNNTPVFFLRDPAKFPHFIHTQKRDPQTHLKDSNMFDYLSQNPESIHQVMILFSDRGTPDGYFHEHGYSGHTFKWLKDDGTFVYTQVHVRADSGFKTLDADTSVKLAGENPDYGTQTLFEAIENGNHPSWTVYVQTMTPEQAESFRYNILDLTKVWPHAEFPLRPVGKLVLNENPQNYFAEIEQSAFSPSHLIPYVEPSADPVLQSRLFSYPDTHRHRLGVNYQQLPVNAPIVPVANFQRDGPATFVSQGARPNYASTIQPLSYKKYKADINSSVRDVERQARHENFIGGAWRDLEEVTELDFEQPRALWSKVWNDEQRAVFVKNVSGHLGTVKSDEIKARQLSVFARVDQSLSDRIAAAIGHSPVQPLAVKPAAEAVRFRANLGFANTFFQRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns) and 2 short ESTs (DN592630, DN592122). Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTCGGCCCAAGTTTGGAACACTAAAGACGGCGCCGTCTATACCACCTCCAACGGTGCCCCCGTCAACGAGCCATATGCCGCCCAGCGTGCTGGTATCAACGGGCCCCTCTTGCTT
CAAG
GTTCGTCGATAGCCACCATCTACGATTTGTTATGCTCACCAACCCCGCCTTTTTCAGACTTCCACCATATCGACCTTCTCGCCCACTTCGATCGTGAACGTATCCCTGAGCGAGTT
GTACGTGCTATTCCCAGCCCGCCGTGCTTGTCTCCGCTGATACTCGCCCTCCAGGTACACGCTAAAGGCGCTGGCGCTCATGGCTACTTCGAGACAACCCACTCGCTCTCCGATATCACT
TCAATTCCCCTCTTCCAAAAGCCAGGAACCAAGGTCCGCGCTACAGTCCGATTTTCGACCGTGGGCGGTGAATCTG
GTATGTTCTCTCATCGCTCTAGATTGCTCTCATGTCCATGTTAT
TCTTCTTCAGGCTCTGCGGATACCGCCAGAGACCCCCGAGGATTCGCGATCAAACTGAGGACGGAAGACGGAAACTGGGACTGGGTCTTCAACAACACCCCTGTCTTCTTCTTGCGCGAC
CCCGCCAAGTTCCCCCACTTCATCCACACGCAGAAGAGGGATCCCCAGACTCACTTGAAAGATAGCAACATGTTCTGG
GTAGGCGTTTCCGGATCATTTCCTGGTCCCTGTACTGGGAGC
TAATGCCTCGCGTGTGATAGGACTATCTCTCCCAAAACCCAGAGTCGATCCATCAAGTCATGATCTTGTTCTCCGACCGCGGGACACCTGATGGCTACTTCCACGAACACGGTTACTCTG
GTCACACCTTCAAGTGGCTCAAGGATGATGGAACCTTTGTCTACACTCAGGTCCACGTCCGAGCTGATAGTGGCTTCAAG
GTTGGTAAAGGCAGCTATCCCCTTATGATCGCGACTGACC
CAGGCATCTATACTAGACTCTCGACGCTGACACTTCGGTCAAGCTTGCTGGTGAAAACCCTGACTATGGCACTCAGACTCTCTTTGAGGCCATCGAGAACGGAAACCACCCCAGTTGGAC
TGTCTACGTC
GTAAGTTCCAACGTTCCTGGACAATATATACTCGCACTGAGTATGTCTATAGCAAACCATGACACCCGAACAAGCTGAATCATTCCGCTACAACATCCTCGATCTGACCA
AAGTCTGGCCTCACGCCGAGTTCCCTCTCCGCCCTGTTG
GTAAGTACCAGTTCGCGTATTCTTGGAATATCTCTTTGATCGCGCTTTTCCAATGCAGGCAAACTTGTTCTGAATGAGAAC
CCACAGAACTACTTCGCGGAGATTGAGCAATCTGCGTTCTCTCCTTCGCACCTGATTCCCTATGTCGAGCCCTCTGCCGACCCCGTCTTGCAGAGCAGGCTGTTCTCGTACCCTGATACC
CATCGCCACCGTCTTG
GTATGGTTTCGAGTTCTTACGTCTTTCAGTTAGCCATTCTGACGCCGATCGGTTTCAGGTGTGAACTACCAACAGCTTCCCGTCAACGCACCCATCGTCCCCGT
CGCCAACTTCCAGCGCGATGGGCCTGCGACATTTGTATCTCAAG
GTTAGTTCCACGTTGGCACGTGTAAAGGGAGGGAAGTAACTCTGGTCCAACAGGAGCGCGCCCCAACTACGCCTCA
ACCATTCAACCTCTTTCGTACAAGAAGTATAAGGCAGATATCAACAGTAGCGTTCGCGACGTCGAACGTCAGGCACGACACGAGAATTTCATTGGTGGTGCTTGGAGGGATTTGGAAGAG
GTTACCGAGC
GTAAGCTACCTTTTCCTTTTGGAGGGCACTATCACTGACATAAATTGGGCGATGTAGTGGACTTCGAACAACCAAGGGCTCTATGGAGCAAAGTTTGGAACGACGAGCAG
AGGGCTGTGTTCGTCAAGAACGTTTCAGGACATCTTGGAACTGTGAAGAGCGACGAGATCAAGGCTAGGCAAC
GTGCGCACCACTGATTTATCTTTCCCCTCTCGAGCGAAGGTCCATAC
TAACTTTGAAAACCCTGCAGTGTCCGTCTTCGCCAGAGTTGACCAAAGCCTCTCTGACCGCATTGCCGCTGCCATTGGACATTCTCCTGTCCAACCGCTCGCTGTCAAGCCCGCTGCCGA
AGCAGTCAGGTTCCGTGCAAACCTCGGGTTCGCCAATACGTTCTTCCAGAGGCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTCGGCCCAAGTTTGGAACACTAAAGACGGCGCCGTCTATACCACCTCCAACGGTGCCCCCGTCAACGAGCCATATGCCGCCCAGCGTGCTGGTATCAACGGGCCCCTCTTGCTT
CAAG
ACTTCCACCATATCGACCTTCTCGCCCACTTCGATCGTGAACGTATCCCTGAGCGAGTTGTACACGCTAAAGGCGCTGGCGCTCATGGCTACTTCGAGACAACCCACTCGCTCTCC
GATATCACTTCAATTCCCCTCTTCCAAAAGCCAGGAACCAAGGTCCGCGCTACAGTCCGATTTTCGACCGTGGGCGGTGAATCTG
GCTCTGCGGATACCGCCAGAGACCCCCGAGGATTC
GCGATCAAACTGAGGACGGAAGACGGAAACTGGGACTGGGTCTTCAACAACACCCCTGTCTTCTTCTTGCGCGACCCCGCCAAGTTCCCCCACTTCATCCACACGCAGAAGAGGGATCCC
CAGACTCACTTGAAAGATAGCAACATGTTCTGG
GACTATCTCTCCCAAAACCCAGAGTCGATCCATCAAGTCATGATCTTGTTCTCCGACCGCGGGACACCTGATGGCTACTTCCACGAA
CACGGTTACTCTGGTCACACCTTCAAGTGGCTCAAGGATGATGGAACCTTTGTCTACACTCAGGTCCACGTCCGAGCTGATAGTGGCTTCAAG
ACTCTCGACGCTGACACTTCGGTCAAG
CTTGCTGGTGAAAACCCTGACTATGGCACTCAGACTCTCTTTGAGGCCATCGAGAACGGAAACCACCCCAGTTGGACTGTCTACGTC
CAAACCATGACACCCGAACAAGCTGAATCATTC
CGCTACAACATCCTCGATCTGACCAAAGTCTGGCCTCACGCCGAGTTCCCTCTCCGCCCTGTTG
GCAAACTTGTTCTGAATGAGAACCCACAGAACTACTTCGCGGAGATTGAGCAATCT
GCGTTCTCTCCTTCGCACCTGATTCCCTATGTCGAGCCCTCTGCCGACCCCGTCTTGCAGAGCAGGCTGTTCTCGTACCCTGATACCCATCGCCACCGTCTTG
GTGTGAACTACCAACAG
CTTCCCGTCAACGCACCCATCGTCCCCGTCGCCAACTTCCAGCGCGATGGGCCTGCGACATTTGTATCTCAAG
GAGCGCGCCCCAACTACGCCTCAACCATTCAACCTCTTTCGTACAAG
AAGTATAAGGCAGATATCAACAGTAGCGTTCGCGACGTCGAACGTCAGGCACGACACGAGAATTTCATTGGTGGTGCTTGGAGGGATTTGGAAGAGGTTACCGAGC
TGGACTTCGAACAA
CCAAGGGCTCTATGGAGCAAAGTTTGGAACGACGAGCAGAGGGCTGTGTTCGTCAAGAACGTTTCAGGACATCTTGGAACTGTGAAGAGCGACGAGATCAAGGCTAGGCAAC
TGTCCGTC
TTCGCCAGAGTTGACCAAAGCCTCTCTGACCGCATTGCCGCTGCCATTGGACATTCTCCTGTCCAACCGCTCGCTGTCAAGCCCGCTGCCGAAGCAGTCAGGTTCCGTGCAAACCTCGGG
TTCGCCAATACGTTCTTCCAGAGGCTGTAG

Retrieve as FASTA