Entry information : CcinKat03
Entry ID 6531
Creation 2009-01-26 (Christophe Dunand)
Last sequence changes 2009-01-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinKat03
Name CcinKat03
Class Catalase    [Orthogroup: Kat002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinKat03
start..stop
S start..stop
CcinKat04 1067 0 1..576 1..578
PnoKat01 822 0 26..561 3..532
CtheKat3 818 0 1..561 14..569
SAcoKat02 814 0 2..568 10..574
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2616225..2616513 289 N° 2 2616577..2616650 74 N° 3 2616706..2616867 162 N° 4 2616920..2617134 215
N° 5 2617189..2618179 991  
join(2616225..2616513,2616577..2616650,2616706..2616867,2616920..2617134,2617189 ..2618179)


exon

Literature and cross-references CcinKat03
Literature Birren et al., The Broad Institute Genome Sequencing Platform. Annotation of the Coprinopsis cinerea genome.
DNA ref. JGI genome:   Chr_7 (2616225..2618176)
Protein sequence: CcinKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   576
PWM (Da):   %s   65233  
PI (pH):   %s   7.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQAAKEAMGAVGVDPRPMQRTSTFMNANDGPAEIIAKVSGVVSAGKRKDDAPYFTNNEGIPWPDPTHSKNVGGLPLISDTFLLQKQQTFNRSKTLERMVHPCGSGAFGYFECTQDMSELTAGLYSKAGKETPIFLRFSTVTFGREFPDSGRNPRGFAIKHYTEDGNYDVVGLNWPIFFCRDPIQGPDVIRSQQRNPQNFLLNYDSLFDFLAHTPEANHAGMMFFSDHGTPNGWRNQHGYGCHTFKWVNAEGKFVYVKYHYLAEHGQKQFTWPEAVRMSGEDPDYAKRDLWAAIERGETPTWTMKVQIMRPEEADPNKLGFDPFDVTKVWPRSRFPMHEVGRLVLNKNPENYHRDVEQSAFSPGSMVPGIEDSPDALLQFRMFFYRDAQYHRLGVNLHQIPVNCPFMAKSYSSINFDGPLRSDANTGMNPHYVPNSFVNKFRPDTAEAPYQVSDNVVSRQSHFWHEGKDSDYEQARDLYFKVMTPEARSHLHTNTAVLLKQVTYKIIVLNYLAQQYRIAPEYAKAIYDLVPEPGFDFSEVEAKAKGAAVMTKEAKFAPTKEFHRSVGIPATGLAYN

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGCCGCCAAAGAAGCTATGGGCGCCGTTGGCGTCGACCCGCGCCCCATGCAGCGCACCTCGACGTTTATGAACGCCAACGACGGCCCTGCAGAGATCATCGCCAAGGTCTCTGGC
GTTGTGTCTGCTGGGAAACGCAAGGATGATGCGCCGTACTTTACCAACAACGAGGGTATCCCATGGCCGGACCCCACCCATAGCAAGAATGTGGGTGGTCTCCCGCTCATTAGCGACACC
TTCCTCTTGCAGAAGCAGCAGACCTTCAACCGAAGCAAGACTCTTGAAC
GTACGTTTAGCTTTATGACTTTTTTCGTGGCAGTATGGAAACTGATTCCTTGCTGCTTGTCAGGCATGGTC
CATCCCTGCGGTTCCGGTGCTTTTGGATATTTCGAGTGTACTCAAGACATGAGCGAACTCACCAAG
GTTAGCGTCATCTCGCCTTGATGATACCCGTCGTTGCGCTGATCCCATGATTTA
GGCAGGTCTCTACAGCAAGGCGGGCAAGGAGACTCCCATCTTCCTTCGCTTCTCGACCGTCACCTTTGGTCGCGAGTTCCCAGACTCTGGCAGGAACCCTCGAGGATTCGCTATCAAGCA
CTACACTGAGGATGGAAACTATGACGTCGTCGGTCTCAACTGG
GTACGTCCTACCTGACATTGGGGGAAGATTCGTTACTTAGCCAGCCTTCTAGCCCATTTTCTTCTGCCGTGACCCCA
TCCAAGGCCCCGATGTCATTCGCTCCCAACAACGAAACCCACAGAACTTCCTGTTGAACTACGACAGTCTCTTCGACTTCCTTGCTCATACACCCGAGGCGAACCATGCCGGTATGATGT
TCTTCAGCGACCATGGCACTCCCAACGGTTGGAGGAACCAGCACGGCTACGGTTGCCACACTTTCAAGTG
GTGAGTGAAGTCCCTCTGTGCATGCTGATACATGCTGAGGAGGGCATTCC
GCAGGGTCAACGCAGAGGGCAAATTCGTCTACGTCAAATACCACTACCTCGCCGAGCACGGCCAGAAGCAGTTCACCTGGCCCGAAGCTGTCCGAATGAGCGGCGAGGACCCCGACTACG
CGAAACGCGACCTCTGGGCTGCCATCGAGCGTGGTGAAACCCCAACCTGGACGATGAAGGTCCAAATCATGCGTCCCGAGGAGGCCGACCCCAACAAGCTCGGCTTTGACCCCTTCGACG
TCACCAAGGTCTGGCCGCGCAGCCGCTTCCCCATGCACGAAGTCGGCCGCCTCGTCCTCAACAAGAACCCAGAGAACTACCACCGCGACGTCGAGCAATCCGCGTTCTCTCCCGGTTCCA
TGGTACCTGGAATTGAGGACTCGCCTGACGCTCTCCTCCAGTTCCGCATGTTCTTCTACCGCGACGCGCAGTACCATCGCCTCGGTGTCAACCTCCACCAAATCCCCGTCAACTGCCCGT
TCATGGCCAAGAGCTACTCCTCCATCAACTTTGACGGTCCTCTCAGGAGTGACGCCAACACTGGCATGAACCCCCACTACGTCCCCAACTCCTTCGTCAACAAGTTCCGCCCAGACACTG
CCGAGGCGCCGTACCAAGTCTCCGACAACGTTGTCTCGCGCCAGTCGCACTTTTGGCATGAAGGCAAGGACTCGGATTACGAGCAGGCGCGCGATTTGTACTTCAAGGTTATGACACCTG
AAGCTAGGAGCCACCTCCACACCAACACGGCAGTCCTCTTGAAGCAGGTCACCTACAAGATAATCGTGCTCAACTATTTGGCGCAGCAGTATCGTATTGCGCCCGAGTATGCGAAGGCGA
TTTATGATCTTGTTCCGGAGCCTGGATTTGACTTTAGTGAGGTCGAGGCGAAGGCGAAGGGCGCTGCGGTGATGACCAAGGAGGCCAAGTTTGCACCCACGAAGGAGTTCCATAGGTCGG
TTGGTATCCCTGCTACTGGGTTGGCTTATAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGCCGCCAAAGAAGCTATGGGCGCCGTTGGCGTCGACCCGCGCCCCATGCAGCGCACCTCGACGTTTATGAACGCCAACGACGGCCCTGCAGAGATCATCGCCAAGGTCTCTGGC
GTTGTGTCTGCTGGGAAACGCAAGGATGATGCGCCGTACTTTACCAACAACGAGGGTATCCCATGGCCGGACCCCACCCATAGCAAGAATGTGGGTGGTCTCCCGCTCATTAGCGACACC
TTCCTCTTGCAGAAGCAGCAGACCTTCAACCGAAGCAAGACTCTTGAAC
GCATGGTCCATCCCTGCGGTTCCGGTGCTTTTGGATATTTCGAGTGTACTCAAGACATGAGCGAACTCACC
AAG
GCAGGTCTCTACAGCAAGGCGGGCAAGGAGACTCCCATCTTCCTTCGCTTCTCGACCGTCACCTTTGGTCGCGAGTTCCCAGACTCTGGCAGGAACCCTCGAGGATTCGCTATCAAG
CACTACACTGAGGATGGAAACTATGACGTCGTCGGTCTCAACTGG
CCCATTTTCTTCTGCCGTGACCCCATCCAAGGCCCCGATGTCATTCGCTCCCAACAACGAAACCCACAGAACTTC
CTGTTGAACTACGACAGTCTCTTCGACTTCCTTGCTCATACACCCGAGGCGAACCATGCCGGTATGATGTTCTTCAGCGACCATGGCACTCCCAACGGTTGGAGGAACCAGCACGGCTAC
GGTTGCCACACTTTCAAGTG
GGTCAACGCAGAGGGCAAATTCGTCTACGTCAAATACCACTACCTCGCCGAGCACGGCCAGAAGCAGTTCACCTGGCCCGAAGCTGTCCGAATGAGCGGC
GAGGACCCCGACTACGCGAAACGCGACCTCTGGGCTGCCATCGAGCGTGGTGAAACCCCAACCTGGACGATGAAGGTCCAAATCATGCGTCCCGAGGAGGCCGACCCCAACAAGCTCGGC
TTTGACCCCTTCGACGTCACCAAGGTCTGGCCGCGCAGCCGCTTCCCCATGCACGAAGTCGGCCGCCTCGTCCTCAACAAGAACCCAGAGAACTACCACCGCGACGTCGAGCAATCCGCG
TTCTCTCCCGGTTCCATGGTACCTGGAATTGAGGACTCGCCTGACGCTCTCCTCCAGTTCCGCATGTTCTTCTACCGCGACGCGCAGTACCATCGCCTCGGTGTCAACCTCCACCAAATC
CCCGTCAACTGCCCGTTCATGGCCAAGAGCTACTCCTCCATCAACTTTGACGGTCCTCTCAGGAGTGACGCCAACACTGGCATGAACCCCCACTACGTCCCCAACTCCTTCGTCAACAAG
TTCCGCCCAGACACTGCCGAGGCGCCGTACCAAGTCTCCGACAACGTTGTCTCGCGCCAGTCGCACTTTTGGCATGAAGGCAAGGACTCGGATTACGAGCAGGCGCGCGATTTGTACTTC
AAGGTTATGACACCTGAAGCTAGGAGCCACCTCCACACCAACACGGCAGTCCTCTTGAAGCAGGTCACCTACAAGATAATCGTGCTCAACTATTTGGCGCAGCAGTATCGTATTGCGCCC
GAGTATGCGAAGGCGATTTATGATCTTGTTCCGGAGCCTGGATTTGACTTTAGTGAGGTCGAGGCGAAGGCGAAGGGCGCTGCGGTGATGACCAAGGAGGCCAAGTTTGCACCCACGAAG
GAGTTCCATAGGTCGGTTGGTATCCCTGCTACTGGGTTGGCTTATAACTAG

Retrieve as FASTA