Entry information : CcinHalPrx02
Entry ID 6553
Creation 2009-01-30 (Christophe Dunand)
Last sequence changes 2010-08-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Christophe Dunand)
Peroxidase information: CcinHalPrx02
Name CcinHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinHalPrx02
start..stop
S start..stop
CcinHalPrx01 570 0 1..295 1..292
LbiHalPrx01 386 3e-136 4..280 7..282
AbHalPrx01_bisporus 370 5e-130 1..280 1..280
LbiHalPrx02 339 9e-118 15..271 18..275
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3102430..3102643 214 N° 2 3102764..3102967 204 N° 3 3103041..3103254 214 N° 4 3103356..3103611 256
join(3102430..3102643,3102764..3102967,3103041..3103254,3103356..3103611)


exon

Literature and cross-references CcinHalPrx02
DNA ref. JGI genome:   Chr_4 (3102430..3103611)
Protein sequence: CcinHalPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   295
PWM (Da):   %s   32100.1  
PI (pH):   %s   5.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVIAGKFRSLRAVTWDAGCTMGNLVWPNRKPGSVTPAGCPGAGGKWPEFVPPKEGDSRCSCPALNAMANHGILPHDGKNIKFSEMGDKIRETYNFAPSFCLFVPNYAATMLGKDFNKDTFDLQELDLHNGIEHDASLTREDAALVPDQSKPHIPFIRELLDSATGTDAEGRKVLTIEDLSKYSAKRRVDARETNPEYTLSKVHRTFGSANSSTLLTIFGGRVDDLESILIEERIPDGWESRILEEFGLTIITFNVKTVNKVERGIDEEKYIAEKKATAAAAAQGNAEGESSGVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 4 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCAGGGAAATTCAGATCATTGCGCGCGGTCACATGGGATGCTGGCTGCACCATGGGGAATCTAGTCTGGCCTAACCGAAAACCTGGGAGCGTGACGCCCGCAGGATGT
CCCGGCGCCGGTGGCAAGTGGCCTGAATTCGTACCTCCCAAAGAAGGCGACAGTCGGTGTTCGTGTCCTGCTTTAAACGCGATGGCTAATCATG
GTACGTACATACATATCATACATACG
TCCTGCTCCTGTACTCGTATTCCCTCGATTGGGTGATTGGATTAACAAGTCATTTTTTTCTTTTCTTTTTTGGGGGGCACTATGTACCATGTAGGTATCCTGCCACACGACGGGAAGAAC
ATCAAGTTCTCAGAAATGGGCGACAAGATTCGCGAAACATACAACTTTGCACCGAGCTTCTGCCTCTTCGTGCCCAACTACGCTGCCACCATGCTGGGGAAGGACTTCAACAAGGACACG
TTCGACCTGCAAGAGCTGGATCTACACAATGGGATTGAGCACGACGCCTCGCTGACCC
GTGTGTCCTTTTCCTTTTGTTCCCCCTCGTCTAACAGGATCGTCCATTTAAATCTTGGCAAT
GCTAATGCTAGGCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCTTTTATTCGTGAGCTTCTTGACTCCGCTACGGGGACAGATGCAGAAGGAAGGAAGGTCCTGAC
CATTGAAGATCTTTCCAAGTACTCCGCGAAGCGCCGCGTCGACGCCCGCGAAACTAACCCCGAATACACCCTCAGCAAGGTCCACAGGACTTTTGGCAGTGCAAA
GTGCGTACATAGCTT
TCAACACTTCAACAGATACTCTTACGTTGAGTGTAATCTGTAATCTGACTTTCTTTTTTTTTTTTTTTCTTTTTTTGTTACGCCAGCTCTTCTACTCTTTTGACCATTTTTGGCGGCCGG
GTGGACGACCTCGAGAGCATCTTGATCGAGGAACGGATCCCTGATGGTTGGGAGTCGAGGATCCTTGAAGAGTTTGGCTTGACGATTATCACGTTCAACGTGAAGACTGTCAATAAGGTG
GAGCGCGGTATCGATGAGGAGAAGTATATCGCTGAGAAGAAGGCGACGGCTGCTGCAGCTGCTCAGGGAAATGCGGAGGGTGAATCGAGCGGCGTTGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCAGGGAAATTCAGATCATTGCGCGCGGTCACATGGGATGCTGGCTGCACCATGGGGAATCTAGTCTGGCCTAACCGAAAACCTGGGAGCGTGACGCCCGCAGGATGT
CCCGGCGCCGGTGGCAAGTGGCCTGAATTCGTACCTCCCAAAGAAGGCGACAGTCGGTGTTCGTGTCCTGCTTTAAACGCGATGGCTAATCATG
GTATCCTGCCACACGACGGGAAGAAC
ATCAAGTTCTCAGAAATGGGCGACAAGATTCGCGAAACATACAACTTTGCACCGAGCTTCTGCCTCTTCGTGCCCAACTACGCTGCCACCATGCTGGGGAAGGACTTCAACAAGGACACG
TTCGACCTGCAAGAGCTGGATCTACACAATGGGATTGAGCACGACGCCTCGCTGACCC
GCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCTTTTATTCGTGAGCTT
CTTGACTCCGCTACGGGGACAGATGCAGAAGGAAGGAAGGTCCTGACCATTGAAGATCTTTCCAAGTACTCCGCGAAGCGCCGCGTCGACGCCCGCGAAACTAACCCCGAATACACCCTC
AGCAAGGTCCACAGGACTTTTGGCAGTGCAAA
CTCTTCTACTCTTTTGACCATTTTTGGCGGCCGGGTGGACGACCTCGAGAGCATCTTGATCGAGGAACGGATCCCTGATGGTTGGGAG
TCGAGGATCCTTGAAGAGTTTGGCTTGACGATTATCACGTTCAACGTGAAGACTGTCAATAAGGTGGAGCGCGGTATCGATGAGGAGAAGTATATCGCTGAGAAGAAGGCGACGGCTGCT
GCAGCTGCTCAGGGAAATGCGGAGGGTGAATCGAGCGGCGTTGCCTAA

Retrieve as FASTA