Entry information : PblKat02
Entry ID 6599
Creation 2009-02-19 (Christophe Dunand)
Last sequence changes 2009-02-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: PblKat02
Name PblKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Mucoraceae Phycomyces
Organism Phycomyces blakesleeanus    [TaxId: 4837 ]
Cellular localisation N/D
Tissue type Vegetative mycelia
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PblKat02
start..stop
S start..stop
RoKat04 958 0 49..728 36..706
RoKat02 897 0 49..728 20..698
RoKat03 852 0 49..728 18..698
SpliKat01 738 0 38..720 11..711
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 531321..531597 277 N° 2 531239..531248 10 N° 3 530880..531112 233 N° 4 530782..530814 33
N° 5 530498..530696 199 N° 6 530310..530394 85 N° 7 528893..530242 1350  
complement(join(528893..530242,530310..530394,530498..530696,530782..530814,5308 80..531112,531239..531248,531321..531597))


exon

Literature and cross-references PblKat02
Literature Richardson,P., Lucas,S., Rokhsar,D., Wang,M. and Lindquist,E.A. DOE Joint Genome Institute Phycomyces blakesleeanus EST project.
DNA ref. JGI genome:   scaffold_29 (531597..528893)
mRNA ref. JGI transcript:   33258
EST ref. GenBank:   EX815889.1 [5' end]   EX815888.1 [3' end]
Protein sequence: PblKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   728 (705)
PWM (Da):   %s   81140.91 (78797.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   6.22 (6.12) Peptide Signal:   %s   cut: 24 range:24-728
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKAYTIGYAITLVFGVLSSGVTAQCPFHKRMTEGGGQDAKLEQLEQYSVNDAGTQETTMFGTKINNTDSLKAGLRGPTLMEDFMMREKVMHFDHERIPERVVHARGVGAHGYFETYEDWSDLTAAKFLRTPGTKTPVFVRFSTVLGSKGSADTVRDVRGFATRFYTEEGLWDVGNIIAPFFVQDAIKFPDLIHAGKPQPNTDVPQAGTAHETAYDFFASEPATIHTVLWALSGRGIPRSFRQVEGFGVHTFRLVNEEGKSVFAKFIWKPLQGLSNLVWDEAQKIAGKDSDFHRNDLYDAINRGDYPEYEFGVQIVQEEDEDKFDFDLLDPTKLIPESLVPFKPLGKMTLNRNVENFFSETEQVTFHLGHVVRGIGFTNDPLLQGRLFSYLDTQINRMGGVNYMQLPINRPINPVHNSQRDGQMQFNIFKGKVAYSPNGLQADTPSMVDAKDGGYIEYPEMVEGRKERGKSAKFFDHYSQAQLFWNSLTPPEQQQLVDGARFEIGKSKSLDVRKRMIEILNHVDNNLAVRVASGVGVEEPANKYKNSNQTSEGLSIDQYPKAKNIRTRTVAILTAPGTDTSDAKKMYDYLDKEGAYVQYVGLALGDQDGLNITQTYTTTASVLFDAAYVPGGKKAIETLMDNVSQFPYEEPLSFVLDTFRHGKPLAATGAGVELLKAARVKVPSSSKSYAEDKGVLVSSSSTSLEEPFKKALIQQRFWSRMPLDKNAK

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGCATATACTATTGGATATGCAATTACTCTGGTCTTTGGTGTCTTATCTTCTGGAGTGACAGCCCAGTGTCCATTTCACAAGAGAATGACAGAAGGTGGTGGACAGGATGCAAAA
CTTGAGCAGCTGGAACAATACTCTGTTAATGATGCCGGAACCCAGGAAACTACCATGTTTGGTACAAAGATCAATAATACAGACAGTCTGAAGGCTGGACTTCGTGGACCTACTCTTATG
GAGGATTTTATGATGCGTGAGAAGGTCATGCATTTTG
GTAAGTATTCGTTCCTTGTATTTATGTTGCAGAACCCTTCAAACATTCAACTGACTTGTTGCATTTAAATAGATCATGAGAGG
TAAAGAGAGAGAAAGAAAGAAGAGAATTTAACTGACTACCTACGCATCTTCTCTTTAATAAGTGTACTAATGACATTGCTATTTGTTTTTTTTTAAAAAAACAATAATAATTTAAATGAA
TAAAGGATCCCAGAGCGCGTAGTCCATGCACGAGGTGTAGGTGCCCATGGTTACTTTGAGACCTACGAAGACTGGTCAGACTTGACTGCCGCAAAGTTCTTGAGAACCCCAGGTACCAAG
ACACCAGTCTTTGTCCGTTTCTCTACCGTACTCGGCTCAAAGGGCTCTGCTGATACCGTCCGTGATGTCCGTGGGTTCGCAACTCGATTTTACACAGAAGAAGGTCTTTGGGATCTTG
GT
GAGTATTTTTTAGCACTACATCCGTAATTTGAAACATAATTAATCAATGCATATTTTTTTTAGTGGGGAATATTATTGCACCATTCTTTGTACAAGGTAAACGCACTAGGCTTTAAAAGG
TGTGATGGTGTGATGGTGTGATAATGTACTGATTTACTGATGTACTGTGTGTGATGTTTAGATGCCATCAAGTTTCCTGACCTGATCCATGCTGGAAAGCCTCAACCAAATACCGATGTT
CCTCAAGCTGGTACAGCACATGAAACAGCTTATGATTTTTTTGCATCCGAGCCTGCAACAATTCACACCGTCCTTTGGGCATTGTCTGGCCGTGGTATTCCTAGAAGTTTCCGACAAGTA
GAAGGTTTTGGTGTTCACAC
GTAAGTACCTTATATATAAGCAACAACAACAACAACACAAAAGTCAAAGGCCTATAATGTATTGATTGGTTTATTTATATTTATATTTATATATGTCCTT
AAGCTTCCGTTTGGTTAATGAAGAGGGAAAGTCTGTGTTTGCCAAATTTATTTGGAAGCCTCTTCAAGGACTTTCAAATCTTGTCTGGGTAAGAACTACATAAACACTTTTCATCAAATG
TTTGTAATGTTTATAAATACGTTGTCTGTTATTAGGACGAAGCTCAGAAGATTGCAGGAAAGGATAGTGATTTCCACCGTAATGATCTCTACGATGCTATCAATAGAGGAGATTACCCAG
AGTATGAGTTTGGTGTACAGATTGTCCAAGAAGAAGACGAAGACAAATTCGACTTTGACCTCTTGGATCCTACCAAGCTTATTCCCGAGTCTCTCGTGCCTTTTAAGCCTCTCGGCAAGA
TGACCCTCAACCGAAACGTAGAGAACTTCTTTTCCGAGACCGAGCAAGTGACATTCCACCTGGGCCATGTTGTCCGAGGCATCGGATTCACCAACGACCCACTCCTTCAGGGTCGCCTGT
TCAGTTATCTCGATACCCAAATCAATCGCATGGGCGGGGTCAATTACATGCAGCTCCCCATCAACCGTCCCATTAATCCTGTTCACAACAGCCAGCGTGATGGCCAGATGCAGTTCAATA
TTTTCAAAGGCAAGGTCGCCTACTCGCCCAATGGACTCCAAGCCGATACTCCATCGATGGTTGACGCAAAGGATGGCGGCTATATTGAATACCCAGAGATGGTCGAAGGCCGCAAGGAAC
GTGGCAAGAGTGCCAAGTTCTTTGATCACTACAGTCAGGCCCAGCTGTTCTGGAACAGTCTTACACCTCCTGAACAACAACAGCTGGTAGATGGTGCTCGCTTTGAGATCGGAAAGTCCA
AGTCGTTGGACGTTCGCAAGCGGATGATTGAGATCCTAAACCATGTTGACAACAATCTGGCAGTCCGTGTAGCCAGTGGTGTTGGTGTTGAAGAACCGGCCAATAAGTATAAGAACTCCA
ACCAGACCTCAGAAGGTCTTTCGATTGATCAGTATCCAAAAGCCAAGAATATCCGTACCCGCACAGTCGCTATTCTTACTGCCCCTGGAACTGACACTAGCGATGCAAAGAAGATGTATG
ATTACTTGGATAAGGAAGGTGCCTACGTACAATATGTTGGTCTTGCGCTTGGCGATCAAGATGGCTTGAATATCACCCAGACCTACACTACCACGGCTTCCGTCTTGTTTGATGCTGCAT
ATGTACCAGGCGGTAAAAAAGCTATTGAGACTCTGATGGATAACGTCAGCCAGTTCCCCTATGAAGAGCCCCTTAGTTTTGTGCTGGACACTTTCCGCCATGGCAAACCCCTTGCTGCAA
CTGGAGCTGGAGTTGAGCTCCTTAAAGCTGCTAGAGTTAAGGTCCCTTCCTCTAGTAAATCATACGCAGAAGATAAGGGAGTCCTGGTCAGCAGTAGCTCTACTAGTCTGGAAGAACCCT
TCAAGAAAGCATTGATACAACAAAGATTCTGGTCAAGAATGCCATTAGATAAGAATGCTAAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGCATATACTATTGGATATGCAATTACTCTGGTCTTTGGTGTCTTATCTTCTGGAGTGACAGCCCAGTGTCCATTTCACAAGAGAATGACAGAAGGTGGTGGACAGGATGCAAAA
CTTGAGCAGCTGGAACAATACTCTGTTAATGATGCCGGAACCCAGGAAACTACCATGTTTGGTACAAAGATCAATAATACAGACAGTCTGAAGGCTGGACTTCGTGGACCTACTCTTATG
GAGGATTTTATGATGCGTGAGAAGGTCATGCATTTTG
ATCATGAGAGGATCCCAGAGCGCGTAGTCCATGCACGAGGTGTAGGTGCCCATGGTTACTTTGAGACCTACGAAGACTGGTCA
GACTTGACTGCCGCAAAGTTCTTGAGAACCCCAGGTACCAAGACACCAGTCTTTGTCCGTTTCTCTACCGTACTCGGCTCAAAGGGCTCTGCTGATACCGTCCGTGATGTCCGTGGGTTC
GCAACTCGATTTTACACAGAAGAAGGTCTTTGGGATCTTG
TGGGGAATATTATTGCACCATTCTTTGTACAAGATGCCATCAAGTTTCCTGACCTGATCCATGCTGGAAAGCCTCAACCA
AATACCGATGTTCCTCAAGCTGGTACAGCACATGAAACAGCTTATGATTTTTTTGCATCCGAGCCTGCAACAATTCACACCGTCCTTTGGGCATTGTCTGGCCGTGGTATTCCTAGAAGT
TTCCGACAAGTAGAAGGTTTTGGTGTTCACAC
CTTCCGTTTGGTTAATGAAGAGGGAAAGTCTGTGTTTGCCAAATTTATTTGGAAGCCTCTTCAAGGACTTTCAAATCTTGTCTGGGAC
GAAGCTCAGAAGATTGCAGGAAAGGATAGTGATTTCCACCGTAATGATCTCTACGATGCTATCAATAGAGGAGATTACCCAGAGTATGAGTTTGGTGTACAGATTGTCCAAGAAGAAGAC
GAAGACAAATTCGACTTTGACCTCTTGGATCCTACCAAGCTTATTCCCGAGTCTCTCGTGCCTTTTAAGCCTCTCGGCAAGATGACCCTCAACCGAAACGTAGAGAACTTCTTTTCCGAG
ACCGAGCAAGTGACATTCCACCTGGGCCATGTTGTCCGAGGCATCGGATTCACCAACGACCCACTCCTTCAGGGTCGCCTGTTCAGTTATCTCGATACCCAAATCAATCGCATGGGCGGG
GTCAATTACATGCAGCTCCCCATCAACCGTCCCATTAATCCTGTTCACAACAGCCAGCGTGATGGCCAGATGCAGTTCAATATTTTCAAAGGCAAGGTCGCCTACTCGCCCAATGGACTC
CAAGCCGATACTCCATCGATGGTTGACGCAAAGGATGGCGGCTATATTGAATACCCAGAGATGGTCGAAGGCCGCAAGGAACGTGGCAAGAGTGCCAAGTTCTTTGATCACTACAGTCAG
GCCCAGCTGTTCTGGAACAGTCTTACACCTCCTGAACAACAACAGCTGGTAGATGGTGCTCGCTTTGAGATCGGAAAGTCCAAGTCGTTGGACGTTCGCAAGCGGATGATTGAGATCCTA
AACCATGTTGACAACAATCTGGCAGTCCGTGTAGCCAGTGGTGTTGGTGTTGAAGAACCGGCCAATAAGTATAAGAACTCCAACCAGACCTCAGAAGGTCTTTCGATTGATCAGTATCCA
AAAGCCAAGAATATCCGTACCCGCACAGTCGCTATTCTTACTGCCCCTGGAACTGACACTAGCGATGCAAAGAAGATGTATGATTACTTGGATAAGGAAGGTGCCTACGTACAATATGTT
GGTCTTGCGCTTGGCGATCAAGATGGCTTGAATATCACCCAGACCTACACTACCACGGCTTCCGTCTTGTTTGATGCTGCATATGTACCAGGCGGTAAAAAAGCTATTGAGACTCTGATG
GATAACGTCAGCCAGTTCCCCTATGAAGAGCCCCTTAGTTTTGTGCTGGACACTTTCCGCCATGGCAAACCCCTTGCTGCAACTGGAGCTGGAGTTGAGCTCCTTAAAGCTGCTAGAGTT
AAGGTCCCTTCCTCTAGTAAATCATACGCAGAAGATAAGGGAGTCCTGGTCAGCAGTAGCTCTACTAGTCTGGAAGAACCCTTCAAGAAAGCATTGATACAACAAAGATTCTGGTCAAGA
ATGCCATTAGATAAGAATGCTAAATAG

Retrieve as FASTA