Entry information : CnKat02_grubiiH99
Entry ID 6642
Creation 2009-03-25 (Christophe Dunand)
Last sequence changes 2012-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-23 (Catherine Mathe (Scipio))
Peroxidase information: CnKat02_grubiiH99
Name CnKat02_grubiiH99
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat02_grubiiH99
start..stop
S start..stop
CnKat02_JEC21 1374 0 1..701 1..701
CfulKat01 801 0 160..681 20..544
FoKat01 787 0 160..681 19..544
GzKat04 701 0 160..701 18..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 230228..230745 518 N° 2 230801..230929 129 N° 3 230983..231156 174 N° 4 231210..231292 83
N° 5 231340..231476 137 N° 6 231538..231755 218 N° 7 231821..231983 163 N° 8 232039..232719 681
join(230228..230745,230801..230929,230983..231156,231210..231292,231340..231476, 231538..231755,231821..231983,232039..232719)


exon

Literature and cross-references CnKat02_grubiiH99
DNA ref. JGI genome:   cneoH99_Chr4 (230228..232719)
Cluster/Prediction ref. JGI gene:   4518
Protein sequence: CnKat02_grubiiH99
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   701
PWM (Da):   %s   77573.6  
PI (pH):   %s   8.02
Sequence 742
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSARNLASGTPYGKNLPTANGTHFEAPSISSTSDSVNSAYSVGYTPVPTAERSYSGLLHGTLSKVFRKGGQEIVVSEEPVSFNSSKADTESTRFNGCPYMNGSIPQTPTPKSTPKSASVAAPVPLPPPSAARLKAQKQNNSIPRDNSNTLADDVGKLTVRSYEKDRDLRSQEVIYTTSNGVPVPHPYVVQRAGVNGPLLLQDFHLIDLLSHFDRERIPERVVHAKGSGAHGIWECTDGLEDLCLANMFQKGATCPLTIRFSTVGGESGSPDLARDPRGFAVKFRTAEGNWDFVANNTPVFFLRDPAKFPHFIHTQKRDPTTHLSGGDDSTMFWDYLSQNPESIHQIMILMSDRGIPAGWRHMHGYYGHTLKVVNDNGGWVYAQFHLISDQGNKFFTSEEASTKSPDWGQKDLYEAIERGEYPSWTMKVQVMTQEQAEDAWEKKRINVFDLTHVWPHGDYPLRTVGKITLNENPSNYFAEIEQATFNPAHMIPGVEPSADPVLQARLFSYPDAHRHRVGPNYQQLPVNQSATPYATGNFQRDGAMAFYNQGGRPAYLSSIEPIKFQEKRVNLNKVHGQFIGEAVSFLSEIRPEDFNAPRALWQKVFSDESKERFIQTVAGHMSTCKRKEIIARQIAIFRQVSPDLGARLEKATGVRGYGSIEGMSFNGTHNGFGVKRGANGLRQDAEVVFNNGAPQKTQRAR

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTGCTCGTAACCTTGCCTCTGGTACTCCGTACGGCAAGAATCTACCGACAGCCAACGGTACACACTTCGAAGCTCCGTCAATATCTTCTACCTCCGACTCAGTTAATTCGGCGTATT
CGGTTGGCTACACTCCTGTGCCAACTGCGGAGCGTTCCTATTCCGGTTTACTTCACGGCACGCTATCCAAAGTATTTCGCAAGGGCGGTCAAGAAATCGTCGTATCTGAAGAGCCTGTGT
CTTTCAACTCTTCCAAGGCTGACACTGAATCTACTCGCTTCAATGGATGTCCTTACATGAACGGCAGTATCCCTCAGACTCCGACACCAAAGTCGACGCCCAAATCAGCTTCAGTGGCCG
CCCCTGTTCCTTTGCCCCCTCCCTCGGCTGCGCGTCTGAAGGCCCAAAAGCAGAATAATTCAATACCTCGAGATAATAGCAACACTCTGGCGGACGATGTGGGAAAGTTGACTGTTCGAT
CATACGAGAAGGATAGGGACCTTAGGTCCCAGGAGGT
GTACGTACTAAGATCCCCCCTTTTGTGACTTCCCCGACTGACAAACACCTCAAAGTATCTATACTACATCCAACGGTGTTCCG
GTCCCCCACCCATATGTTGTTCAGCGGGCTGGTGTTAACGGTCCCCTTCTTCTGCAAGACTTCCACTTGATCGACTTACTCTCTCACTTTGATCGCGAAAG
GTGAGCCCGATCATTACTT
GATTCCTAAATCTTGAGGACTGACTTTTGCATAGGATCCCTGAACGAGTGGTTCATGCCAAGGGCTCAGGTGCCCATGGTATCTGGGAGTGTACTGACGGCCTAGAGGACCTCTGCCTCG
CGAACATGTTCCAAAAGGGCGCTACTTGTCCTTTGACTATCCGATTTTCAACTGTCGGGGGAGAGTCAGGATCCCCTGACCTTGCTCG
GTGAGTAGTCTAATCTTTCTTCTCAGAATGCT
TGAACTGACGTTCAAACGTAGTGATCCTCGTGGTTTTGCTGTCAAATTTAGAACGGCTGAGGGTAACTGGGACTTTGTTGCGAATAACACTCCCGTTTTCTTTCGTGGGTTACACCCTTA
TACTTAGGAAACAGTTGCTGACATATTTTAGTGCGCGATCCAGCCAAGTTCCCCCACTTCATTCACACTCAGAAACGGGACCCAACCACCCATCTTAGTGGCGGAGATGATTCCACCATG
TTCTGGGACTACCTTTCTCAAAATCCTGAATCCATTCACCAGATCATG
GTACGTTATTATATTGTACACTAAACCAACTCGACAAATGCTGACAGCCTTGGGTACACAGATACTCATGTC
TGACCGAGGCATTCCCGCGGGATGGCGTCACATGCATGGTTATTACGGACACACCCTCAAGGTCGTTAATGACAACGGCGGCTGGGTTTATGCCCAATTCCACCTCATCTCTGACCAGGG
CAACAAGTTCTTTACGAGCGAAGAGGCATCTACCAAATCGCCTGACTGGGGTCAGAAGGATTTGTACGAAGCTATTGAGCGTGGAGA
GTACGTTTTGACTTTATTCCTGATAGATTCCTC
TTCAAAAATTGTTTACTGACTTATTTTCTTAGGTATCCATCTTGGACGATGAAGGTCCAAGTTATGACACAAGAACAAGCAGAGGATGCGTGGGAAAAGAAGCGGATCAATGTCTTTGAC
TTGACCCACGTCTGGCCTCATGGAGACTATCCACTCAGGACTGTAGGCAAGATCACCTTGAATGAGAACCCCAGT
GTAGGTCAGCTTTAATGCAATATTATGGTATCATATCTGAGTTGA
TCTTCTGTAGAATTACTTTGCTGAGATTGAGCAAGCGACGTTCAACCCTGCTCACATGATCCCAGGCGTAGAACCCTCTGCCGACCCTGTACTCCAAGCCCGACTGTTCTCTTACCCTGA
CGCGCACCGCCACCGTGTTGGTCCCAACTACCAACAGCTTCCAGTCAACCAATCGGCCACCCCTTACGCAACGGGAAACTTTCAACGTGATGGTGCCATGGCTTTCTACAATCAGGGAGG
AAGACCCGCTTATCTCTCCAGTATCGAGCCCATCAAGTTCCAAGAGAAGCGCGTCAACCTTAACAAAGTGCACGGTCAATTTATCGGTGAAGCTGTCAGCTTCCTCAGCGAGATCCGTCC
TGAGGACTTTAACGCCCCTCGCGCCCTTTGGCAGAAAGTGTTTAGCGACGAGTCAAAGGAACGTTTCATTCAGACTGTTGCCGGGCACATGTCGACCTGCAAGCGCAAGGAGATTATTGC
CCGTCAAATTGCCATTTTCCGACAAGTATCGCCTGATCTTGGAGCTCGTCTCGAGAAGGCCACTGGCGTCAGGGGCTATGGGAGTATTGAGGGGATGTCTTTCAACGGTACTCATAATGG
CTTTGGCGTTAAGCGTGGGGCGAACGGCCTTCGACAAGATGCGGAGGTTGTGTTCAATAATGGTGCTCCTCAGAAGACTCAGAGGGCTCGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTGCTCGTAACCTTGCCTCTGGTACTCCGTACGGCAAGAATCTACCGACAGCCAACGGTACACACTTCGAAGCTCCGTCAATATCTTCTACCTCCGACTCAGTTAATTCGGCGTATT
CGGTTGGCTACACTCCTGTGCCAACTGCGGAGCGTTCCTATTCCGGTTTACTTCACGGCACGCTATCCAAAGTATTTCGCAAGGGCGGTCAAGAAATCGTCGTATCTGAAGAGCCTGTGT
CTTTCAACTCTTCCAAGGCTGACACTGAATCTACTCGCTTCAATGGATGTCCTTACATGAACGGCAGTATCCCTCAGACTCCGACACCAAAGTCGACGCCCAAATCAGCTTCAGTGGCCG
CCCCTGTTCCTTTGCCCCCTCCCTCGGCTGCGCGTCTGAAGGCCCAAAAGCAGAATAATTCAATACCTCGAGATAATAGCAACACTCTGGCGGACGATGTGGGAAAGTTGACTGTTCGAT
CATACGAGAAGGATAGGGACCTTAGGTCCCAGGAGGT
TATCTATACTACATCCAACGGTGTTCCGGTCCCCCACCCATATGTTGTTCAGCGGGCTGGTGTTAACGGTCCCCTTCTTCTGC
AAGACTTCCACTTGATCGACTTACTCTCTCACTTTGATCGCGAAAG
GATCCCTGAACGAGTGGTTCATGCCAAGGGCTCAGGTGCCCATGGTATCTGGGAGTGTACTGACGGCCTAGAGG
ACCTCTGCCTCGCGAACATGTTCCAAAAGGGCGCTACTTGTCCTTTGACTATCCGATTTTCAACTGTCGGGGGAGAGTCAGGATCCCCTGACCTTGCTCG
TGATCCTCGTGGTTTTGCTG
TCAAATTTAGAACGGCTGAGGGTAACTGGGACTTTGTTGCGAATAACACTCCCGTTTTCTTTC
TGCGCGATCCAGCCAAGTTCCCCCACTTCATTCACACTCAGAAACGGGACCCAACCA
CCCATCTTAGTGGCGGAGATGATTCCACCATGTTCTGGGACTACCTTTCTCAAAATCCTGAATCCATTCACCAGATCATG
ATACTCATGTCTGACCGAGGCATTCCCGCGGGATGGCGTC
ACATGCATGGTTATTACGGACACACCCTCAAGGTCGTTAATGACAACGGCGGCTGGGTTTATGCCCAATTCCACCTCATCTCTGACCAGGGCAACAAGTTCTTTACGAGCGAAGAGGCAT
CTACCAAATCGCCTGACTGGGGTCAGAAGGATTTGTACGAAGCTATTGAGCGTGGAGA
GTATCCATCTTGGACGATGAAGGTCCAAGTTATGACACAAGAACAAGCAGAGGATGCGTGGG
AAAAGAAGCGGATCAATGTCTTTGACTTGACCCACGTCTGGCCTCATGGAGACTATCCACTCAGGACTGTAGGCAAGATCACCTTGAATGAGAACCCCAGT
AATTACTTTGCTGAGATTG
AGCAAGCGACGTTCAACCCTGCTCACATGATCCCAGGCGTAGAACCCTCTGCCGACCCTGTACTCCAAGCCCGACTGTTCTCTTACCCTGACGCGCACCGCCACCGTGTTGGTCCCAACT
ACCAACAGCTTCCAGTCAACCAATCGGCCACCCCTTACGCAACGGGAAACTTTCAACGTGATGGTGCCATGGCTTTCTACAATCAGGGAGGAAGACCCGCTTATCTCTCCAGTATCGAGC
CCATCAAGTTCCAAGAGAAGCGCGTCAACCTTAACAAAGTGCACGGTCAATTTATCGGTGAAGCTGTCAGCTTCCTCAGCGAGATCCGTCCTGAGGACTTTAACGCCCCTCGCGCCCTTT
GGCAGAAAGTGTTTAGCGACGAGTCAAAGGAACGTTTCATTCAGACTGTTGCCGGGCACATGTCGACCTGCAAGCGCAAGGAGATTATTGCCCGTCAAATTGCCATTTTCCGACAAGTAT
CGCCTGATCTTGGAGCTCGTCTCGAGAAGGCCACTGGCGTCAGGGGCTATGGGAGTATTGAGGGGATGTCTTTCAACGGTACTCATAATGGCTTTGGCGTTAAGCGTGGGGCGAACGGCC
TTCGACAAGATGCGGAGGTTGTGTTCAATAATGGTGCTCCTCAGAAGACTCAGAGGGCTCGT

Retrieve as FASTA