Entry information : CnKat02_JEC21 (CAT1)
Entry ID 6643
Creation 2009-03-25 (Christophe Dunand)
Last sequence changes 2009-03-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: CnKat02_JEC21 (CAT1)
Name (synonym) CnKat02_JEC21 (CAT1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat02_JEC21
start..stop
S start..stop
CnKat02_grubiiH99 1374 0 1..701 1..701
CfulKat01 800 0 160..681 20..544
FoKat01 791 0 160..681 19..544
GzKat04 706 0 160..701 18..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 663296..663813 518 N° 2 663112..663240 129 N° 3 662885..663058 174 N° 4 662749..662831 83
N° 5 662553..662689 137 N° 6 662274..662491 218 N° 7 662047..662209 163 N° 8 661307..661990 684
complement(join(661307..661990,662047..662209,662274..662491,662553..662689,6627 49..662831,662885..663058,663112..663240,663296..663813))


exon

Literature and cross-references CnKat02_JEC21 (CAT1)
DNA ref. JGI genome:   NC_006681 (663813..661307)
mRNA ref. GenBank:   XM_568133
Cluster/Prediction ref. UniGene:   Fne.4429
Protein sequence: CnKat02_JEC21 (CAT1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   701
PWM (Da):   %s   77655.64  
PI (pH):   %s   8.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSARNLASGTPYRKNLSPANSSHFDAPSVSSTSDSVKSAYSVGYTPVPTADRSYSGLLHGTLSKVFRKGGQEIIVSEEPVSFSSSKEDSESTRFNGCPYMNGSIPQTPTPKSTSKSASVAVPVPLPPPSAARLKVQKQNDSIPRENGNALADDVGKLTVRSYEKDRDLKSQEVIYTTSNGVPVPHPYAVQRAGVNGPLLLQDFHLIDLLSHFDRERIPERVVHAKGSGAHGTWECTDGLEDLCLANMFQKGTTCPLTIRFSTVGGESGSPDLARDPRGFAVKFRTAEGNWDFVANNTPVFLRDPAKFPHFIHTQKRDPATHLSGGDDSTMFWDYLSQNPESIHQVILMSDRGIPAGWRHMHGYYGHTLKIVNDNGDWVYAQFHLISDQGNKFFTSEEASTKSPDWGQKDLYEAIGRGEYPSWTMKVQVMTQEQAEEAWEKKRINVFDLTHVWPHGDYPLRTIGKITLNENPNYFAEVEQATFNPAHMIPGVEPSADPVLQARLFSYPDAHRHRVGANYQQLPVNQSATPYATGNFQRDGAMAFYNQGGRPAYLSSIEPIKFREKRVNLNKVHGQFIGEAVSFLSEIRPEDFNAPRALWQKVFSDESKERFIQTVAGHMSTCKRKEIIARQIAIFRQVSPDLGARLEKATNVRGYGSIEGMSFNGTHNGFGVKRGANGLRQDADVVFNNGAPQKTQRAR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 12, 7 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCGTAACCTAGCCTCTGGTACGCCGTACCGCAAGAACCTGTCGCCAGCCAACAGTTCGCACTTCGATGCTCCGTCAGTATCTTCTACTTCCGACTCAGTCAAGTCGGCATAT
TCTGTTGGCTACACTCCTGTGCCAACTGCCGACCGTTCCTATTCCGGTTTACTTCACGGCACACTATCCAAAGTGTTCCGCAAGGGCGGTCAAGAAATCATTGTATCCGAAGAGCCTGTG
TCTTTTAGCTCTTCCAAGGAAGACTCTGAATCCACTCGCTTCAATGGCTGTCCTTACATGAACGGTAGTATCCCTCAGACTCCGACACCAAAGTCGACGTCCAAATCAGCTTCAGTTGCC
GTTCCTGTTCCTTTGCCCCCTCCTTCTGCTGCGCGTCTGAAGGTCCAAAAACAAAATGATTCAATCCCTCGAGAGAATGGCAACGCTCTGGCGGACGATGTGGGAAAGTTGACTGTTCGA
TCATACGAGAAGGATAGGGACCTTAAGTCCCAGGAGGT
GTACGTATTAAGGTCCCGCCTTTTTTAACTTCCTAGACTGACAAGCACCTCAAAGTATCTATACTACATCCAACGGTGTTCC
GGTGCCCCACCCGTATGCTGTTCAGCGGGCTGGTGTTAACGGTCCCCTTCTTCTGCAAGACTTCCATTTGATTGACTTACTCTCTCACTTTGATCGCGAAAG
GTGAGTCTGATCATGACT
TGGTTCCTAAACCTTGAGGACTGACTTTTGCATAGGATCCCCGAAAGAGTGGTCCATGCCAAGGGCTCAGGTGCCCATGGTACCTGGGAGTGTACAGACGGCCTAGAGGACCTCTGCCTC
GCCAACATGTTCCAAAAGGGCACTACCTGTCCTTTGACTATTCGATTTTCAACCGTCGGGGGAGAATCGGGATCTCCTGACCTTGCTCG
GTAAGTAGTCTAATATTTCTCCTTAGGATTC
TTGAACTGACGTTCAAGCTTAGTGATCCTCGTGGTTTTGCTGTCAAATTTAGAACGGCTGAGGGTAACTGGGACTTCGTTGCGAATAACACTCCCGTTTTCTTTCGTGAGTTACGCCCTT
TTACCTAGCGTAATGGACAAAAATAATTTGCTGACATATTGTAGTGCGCGACCCAGCCAAGTTCCCTCACTTCATTCACACTCAGAAACGGGACCCAGCCACCCATCTTAGCGGCGGAGA
TGATTCCACCATGTTCTGGGACTACCTTTCTCAGAATCCTGAATCCATTCACCAGGTCATG
GTACGTTATCATATTGTACACTAAACCAACTCGCCAAATGCTGACAGCCTTGGATAAAC
AGATACTCATGTCTGATCGAGGCATTCCCGCGGGATGGCGTCACATGCATGGTTATTACGGGCACACCCTCAAGATCGTTAATGACAATGGCGACTGGGTTTATGCCCAATTCCACCTCA
TCTCTGACCAGGGCAACAAGTTCTTTACGAGCGAGGAGGCATCTACCAAATCACCTGACTGGGGTCAGAAGGACTTGTACGAAGCTATTGGGCGTGGAGA
GTACGTTTTGACTTTATTCC
TGATAAATTCATCTTCAAAGACGTTTACTGACTTACTTTCGCAGGTACCCATCTTGGACGATGAAGGTCCAAGTTATGACACAAGAACAAGCAGAGGAGGCATGGGAAAAGAAGCGGATC
AATGTCTTTGACTTGACCCACGTCTGGCCTCATGGAGATTATCCACTCAGGACTATAGGCAAGATCACCTTGAATGAGAATCCTAGT
GTAAGTCAGCTTATAATGCAATACTATGGTATC
ATATCTGAGTTGATCTTCTGTAGAATTACTTTGCTGAGGTTGAGCAAGCGACGTTCAACCCTGCTCACATGATCCCAGGCGTAGAACCCTCTGCCGACCCTGTACTCCAAGCCCGACTGT
TCTCTTACCCTGACGCGCACCGCCACCGTGTTGGTGCCAACTACCAACAGCTTCCAGTCAATCAATCGGCCACCCCTTACGCAACGGGCAACTTTCAACGCGATGGTGCCATGGCTTTCT
ACAATCAGGGAGGAAGACCCGCTTATCTCTCCAGTATCGAGCCCATCAAGTTCCGAGAGAAGCGCGTCAACCTTAACAAAGTGCACGGTCAATTTATCGGTGAAGCTGTCAGCTTCCTCA
GCGAGATCCGTCCTGAGGACTTTAACGCCCCTCGTGCCCTTTGGCAGAAAGTGTTCAGCGACGAGTCAAAGGAACGTTTCATTCAGACTGTCGCCGGGCACATGTCGACCTGCAAGCGCA
AGGAAATTATTGCCCGTCAAATTGCCATTTTCCGACAAGTATCGCCTGATCTTGGTGCTCGTCTCGAGAAGGCCACCAATGTCAGGGGCTATGGGAGTATTGAGGGGATGTCTTTCAACG
GTACTCATAATGGCTTTGGTGTTAAGCGTGGGGCGAACGGCCTTCGCCAAGATGCGGACGTTGTGTTCAATAATGGTGCTCCTCAGAAGACTCAGAGGGCTCGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCGTAACCTAGCCTCTGGTACGCCGTACCGCAAGAACCTGTCGCCAGCCAACAGTTCGCACTTCGATGCTCCGTCAGTATCTTCTACTTCCGACTCAGTCAAGTCGGCATAT
TCTGTTGGCTACACTCCTGTGCCAACTGCCGACCGTTCCTATTCCGGTTTACTTCACGGCACACTATCCAAAGTGTTCCGCAAGGGCGGTCAAGAAATCATTGTATCCGAAGAGCCTGTG
TCTTTTAGCTCTTCCAAGGAAGACTCTGAATCCACTCGCTTCAATGGCTGTCCTTACATGAACGGTAGTATCCCTCAGACTCCGACACCAAAGTCGACGTCCAAATCAGCTTCAGTTGCC
GTTCCTGTTCCTTTGCCCCCTCCTTCTGCTGCGCGTCTGAAGGTCCAAAAACAAAATGATTCAATCCCTCGAGAGAATGGCAACGCTCTGGCGGACGATGTGGGAAAGTTGACTGTTCGA
TCATACGAGAAGGATAGGGACCTTAAGTCCCAGGAGGT
TATCTATACTACATCCAACGGTGTTCCGGTGCCCCACCCGTATGCTGTTCAGCGGGCTGGTGTTAACGGTCCCCTTCTTCTG
CAAGACTTCCATTTGATTGACTTACTCTCTCACTTTGATCGCGAAAG
GATCCCCGAAAGAGTGGTCCATGCCAAGGGCTCAGGTGCCCATGGTACCTGGGAGTGTACAGACGGCCTAGAG
GACCTCTGCCTCGCCAACATGTTCCAAAAGGGCACTACCTGTCCTTTGACTATTCGATTTTCAACCGTCGGGGGAGAATCGGGATCTCCTGACCTTGCTCG
TGATCCTCGTGGTTTTGCT
GTCAAATTTAGAACGGCTGAGGGTAACTGGGACTTCGTTGCGAATAACACTCCCGTTTTCTTTC
TGCGCGACCCAGCCAAGTTCCCTCACTTCATTCACACTCAGAAACGGGACCCAGCC
ACCCATCTTAGCGGCGGAGATGATTCCACCATGTTCTGGGACTACCTTTCTCAGAATCCTGAATCCATTCACCAGGTCATG
ATACTCATGTCTGATCGAGGCATTCCCGCGGGATGGCGT
CACATGCATGGTTATTACGGGCACACCCTCAAGATCGTTAATGACAATGGCGACTGGGTTTATGCCCAATTCCACCTCATCTCTGACCAGGGCAACAAGTTCTTTACGAGCGAGGAGGCA
TCTACCAAATCACCTGACTGGGGTCAGAAGGACTTGTACGAAGCTATTGGGCGTGGAGA
GTACCCATCTTGGACGATGAAGGTCCAAGTTATGACACAAGAACAAGCAGAGGAGGCATGG
GAAAAGAAGCGGATCAATGTCTTTGACTTGACCCACGTCTGGCCTCATGGAGATTATCCACTCAGGACTATAGGCAAGATCACCTTGAATGAGAATCCTAGT
AATTACTTTGCTGAGGTT
GAGCAAGCGACGTTCAACCCTGCTCACATGATCCCAGGCGTAGAACCCTCTGCCGACCCTGTACTCCAAGCCCGACTGTTCTCTTACCCTGACGCGCACCGCCACCGTGTTGGTGCCAAC
TACCAACAGCTTCCAGTCAATCAATCGGCCACCCCTTACGCAACGGGCAACTTTCAACGCGATGGTGCCATGGCTTTCTACAATCAGGGAGGAAGACCCGCTTATCTCTCCAGTATCGAG
CCCATCAAGTTCCGAGAGAAGCGCGTCAACCTTAACAAAGTGCACGGTCAATTTATCGGTGAAGCTGTCAGCTTCCTCAGCGAGATCCGTCCTGAGGACTTTAACGCCCCTCGTGCCCTT
TGGCAGAAAGTGTTCAGCGACGAGTCAAAGGAACGTTTCATTCAGACTGTCGCCGGGCACATGTCGACCTGCAAGCGCAAGGAAATTATTGCCCGTCAAATTGCCATTTTCCGACAAGTA
TCGCCTGATCTTGGTGCTCGTCTCGAGAAGGCCACCAATGTCAGGGGCTATGGGAGTATTGAGGGGATGTCTTTCAACGGTACTCATAATGGCTTTGGTGTTAAGCGTGGGGCGAACGGC
CTTCGCCAAGATGCGGACGTTGTGTTCAATAATGGTGCTCCTCAGAAGACTCAGAGGGCTCGTTGA

Retrieve as FASTA