Entry information : CnKat04_grubiiH99
Entry ID 6644
Creation 2009-03-25 (Christophe Dunand)
Last sequence changes 2012-05-07 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-05-22 (Catherine Mathe)
Peroxidase information: CnKat04_grubiiH99
Name CnKat04_grubiiH99
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat04_grubiiH99
start..stop
S start..stop
CnKat04_B-3501A 1032 0 1..498 1..498
CnKat04_JEC21 1031 0 1..498 1..498
NcKat04 634 0 5..496 6..489
SAcoKat01 579 0 6..496 8..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 861587..861623 37 N° 2 861173..861537 365 N° 3 861023..861115 93 N° 4 860966..860973 8
N° 5 860793..860916 124 N° 6 860454..860741 288 N° 7 860313..860397 85 N° 8 859844..860263 420
N° 9 859716..859789 74  
complement(join(859716..859789,859844..860263,860313..860397,860454..860741,8607 93..860916,860966..860973,861023..861115,861173..861537,861587..861623))


exon

Literature and cross-references CnKat04_grubiiH99
DNA ref. JGI genome:   cneoH99_Chr4 (861623..859716)
Protein sequence: CnKat04_grubiiH99
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498
PWM (Da):   %s   55733.45  
PI (pH):   %s   7.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTEKTPTYTLSEGCPIADATTAQRLGSCPVKGLMLMQDTQLIETLAHFSRERIPERTVHASAVGAWGEFEVTHDNSDITSAAFLNGIGKKSKVLMRISTVGPEAGAAETVRDVRGWSMKIFTEEGNQDFVFNSPVFFIRDPIKFPSVNRSHKRHPAKHTADSSMFWDFHNNNPEGTHAVMMLFSNRGLPYSLRQINGYSGHTYKLTKDGSFVYVKLHFKSNQGVKGMTQAEGVRTAGEAPDFHSTDMWNAIERGDYPTWTLYAQVMKPEEAENYRWNIFDMTKVWPHKDFPLRPLGKLTLNRNPENYFSDIEQAAFSPSTMVPGIAPSGDPMLQARMFAYPDAARYRLGVNYQQLPCNRPVSEVYAPYQRDGAMRYMTNYGGDPNYVRSSLKEINFKGQLGAKGHSTGGNEKHDEWVGRVAAYTTETTDEDYVQPRMFWEVLGKAGDQEDLITNVSCHLSKAIPSLQKGAVEIFAKVNVDLAKSIEDRLAELNKG

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTGAGAAAACACCCACATACACCCTGTCCGAAGGTCTGTCGGATCATCCCAGCTAAAACACGATGGGTGCTGACCAATATAGGGTGCCCTATTGCGGATGCTACGACCGCCCAGCG
TCTGGGCAGCTGCCCCGTTAAGGGCCTGATGTTGATGCAGGACACCCAGCTCATCGAGACTCTGGCCCACTTCAGTAGAGAGCGCATTCCCGAGCGTACCGTGCACGCTTCTGCCGTTGG
CGCATGGGGCGAATTTGAAGTAACTCACGACAATTCCGACATCACTTCGGCTGCTTTCCTCAATGGGATTGGCAAAAAGTCCAAGGTTCTTATGCGTATCTCCACTGTGGGACCGGAGGC
TGGCGCAGCCGAGACTGTTCGAGATGTGAGGGGTTGGTCGATGAAAATCTTCACTGAAGAGGGCAACCAAGACTTTGTCTTCAACAGCATT
GTACGTGGCCGACTCCGTTCTCCATGTGC
TGGTTGTATGGGTGCTGAAGCCCTCTAGCCGGTGTTCTTCATCCGGGACCCAATCAAATTCCCCTCTGTTAACCGATCTCACAAGCGTCATCCCGCGAAACACACCGCCGACTCTTCTAT
G
GTGAGTGGTTGAACTTCCACGTTGGTTGCCCCAGTTGATTATTATGCAGTTCTGGGAGTGCGTTTCGTTTTACATCCACGACATGGTGGCCATACTTACAGTTTAGCTTTCACAACAAC
AACCCGGAGGGTACTCATGCCGTCATGATGTTATTTAGCAATCGAGGGCTGCCGTATTCGCTGAGGCAAATCAACGGCTACAGTGGTCACACTTACAAGCTCACCAAATCG
GTTTGTGCC
TAATTTTTTTCAAAACCAGCGAATCATTGACTCTTTCTTTAGGATGGCTCTTTTGTTTATGTCAAACTTCACTTCAAGTCCAACCAAGGTGTCAAGGGCATGACGCAGGCCGAAGGCGTA
CGCACCGCCGGCGAAGCACCCGATTTCCACTCGACCGATATGTGGAATGCTATCGAGCGGGGCGACTACCCTACTTGGACGTTGTATGCTCAAGTCATGAAGCCCGAAGAGGCCGAAAAT
TACCGCTGGAATATCTTCGATATGACCAAGGTTTGGCCTCACAAAGACTTCCCCCTCAGGCCCCTTGGTAAATTGACCCTAAACCGTAAC
GTGAGTGTTATCGGGGATGCTTTTCATAGA
CTAATCAATATCTTTCTGACGAATAGCCCGAAAACTACTTCTCCGACATTGAGCAAGCTGCCTTTTCGCCCTCGACAATGGTGCCGGGCATTGCGCCCTCCGGAGATCCAAGTAGGCCGC
ATCCTTTGTTTAAAGTATTGTAGCCGCTGACTCCAATAAGTGCTGCAAGCTAGGATGTTTGCCTACCCCGATGCCGCTCGATACCGCCTCGGTGTCAACTACCAACAACTTCCGTGCAAT
CGGCCCGTCAGTGAGGTTTATGCGCCCTACCAGCGTGACGGTGCGATGCGCTACATGACCAATTATGGAGGTGATCCCAATTATGTGCGATCCTCTCTCAAGGAGATCAACTTCAAGGGT
CAACTGGGCGCAAAGGGCCATTCCACTGGGGGTAACGAGAAACACGATGAATGGGTCGGTCGAGTTGCGGCGTACACAACCGAGACAACGGATGAGGATTACGTCCAGCCTCGCATGTTC
TGGGAGGTTCTCGGAAAAGCTGGCGACCAAGAGGACTTGATCACCAATGTCTCGTGTCATTTAAGCAAGGCTATCCCGTCGTTGCAGAAAGGAGCTGTCG
GTGAGTGATCGGCGAAGAAT
GTTTTGCTGGCAAGAGATGTTAACTTGACTATAGAAATCTTCGCCAAGGTGAATGTTGATTTGGCCAAGTCCATCGAAGACCGTTTGGCTGAGCTCAACAAGGGAAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTGAGAAAACACCCACATACACCCTGTCCGAAGGGTGCCCTATTGCGGATGCTACGACCGCCCAGCGTCTGGGCAGCTGCCCCGTTAAGGGCCTGATGTTGATGCAGGACACCCAG
CTCATCGAGACTCTGGCCCACTTCAGTAGAGAGCGCATTCCCGAGCGTACCGTGCACGCTTCTGCCGTTGGCGCATGGGGCGAATTTGAAGTAACTCACGACAATTCCGACATCACTTCG
GCTGCTTTCCTCAATGGGATTGGCAAAAAGTCCAAGGTTCTTATGCGTATCTCCACTGTGGGACCGGAGGCTGGCGCAGCCGAGACTGTTCGAGATGTGAGGGGTTGGTCGATGAAAATC
TTCACTGAAGAGGGCAACCAAGACTTTGTCTTCAACAGCATT
CCGGTGTTCTTCATCCGGGACCCAATCAAATTCCCCTCTGTTAACCGATCTCACAAGCGTCATCCCGCGAAACACACC
GCCGACTCTTCTATG
TTCTGGGACTTTCACAACAACAACCCGGAGGGTACTCATGCCGTCATGATGTTATTTAGCAATCGAGGGCTGCCGTATTCGCTGAGGCAAATCAACGGCTACAGT
GGTCACACTTACAAGCTCACCAAATCG
GATGGCTCTTTTGTTTATGTCAAACTTCACTTCAAGTCCAACCAAGGTGTCAAGGGCATGACGCAGGCCGAAGGCGTACGCACCGCCGGCGAA
GCACCCGATTTCCACTCGACCGATATGTGGAATGCTATCGAGCGGGGCGACTACCCTACTTGGACGTTGTATGCTCAAGTCATGAAGCCCGAAGAGGCCGAAAATTACCGCTGGAATATC
TTCGATATGACCAAGGTTTGGCCTCACAAAGACTTCCCCCTCAGGCCCCTTGGTAAATTGACCCTAAACCGTAAC
CCCGAAAACTACTTCTCCGACATTGAGCAAGCTGCCTTTTCGCCC
TCGACAATGGTGCCGGGCATTGCGCCCTCCGGAGATCCAA
TGCTGCAAGCTAGGATGTTTGCCTACCCCGATGCCGCTCGATACCGCCTCGGTGTCAACTACCAACAACTTCCGTGCAAT
CGGCCCGTCAGTGAGGTTTATGCGCCCTACCAGCGTGACGGTGCGATGCGCTACATGACCAATTATGGAGGTGATCCCAATTATGTGCGATCCTCTCTCAAGGAGATCAACTTCAAGGGT
CAACTGGGCGCAAAGGGCCATTCCACTGGGGGTAACGAGAAACACGATGAATGGGTCGGTCGAGTTGCGGCGTACACAACCGAGACAACGGATGAGGATTACGTCCAGCCTCGCATGTTC
TGGGAGGTTCTCGGAAAAGCTGGCGACCAAGAGGACTTGATCACCAATGTCTCGTGTCATTTAAGCAAGGCTATCCCGTCGTTGCAGAAAGGAGCTGTCG
AAATCTTCGCCAAGGTGAAT
GTTGATTTGGCCAAGTCCATCGAAGACCGTTTGGCTGAGCTCAACAAGGGAAAG

Retrieve as FASTA