Entry information : CcinLDS01
Entry ID 6646
Creation 2009-03-29 (Christophe Dunand)
Last sequence changes 2009-03-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinLDS01
Name CcinLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinLDS01
start..stop
S start..stop
LbiLDS01 1198 0 4..1089 6..1073
JargLDS01 1035 0 2..1086 3..1067
AbLDS01_burnettii 1006 0 1..1088 4..1084
AbLDS01_bisporus 995 0 1..1088 4..1084
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1201226..1201390 165 N° 2 1201451..1201513 63 N° 3 1201564..1201645 82 N° 4 1201702..1202231 530
N° 5 1202296..1202446 151 N° 6 1202511..1202575 65 N° 7 1202639..1203089 451 N° 8 1203151..1203194 44
N° 9 1203253..1204257 1005 N° 10 1204317..1205030 714  
join(1201226..1201390,1201451..1201513,1201564..1201645,1201702..1202231,1202296 ..1202446,1202511..1202575,1202639..1203089,1203151..1203194,1203253..1204257,12 04317..1205030)


exon

Literature and cross-references CcinLDS01
DNA ref. JGI genome:   Chr_12 (1201226..1205027)
EST ref. GenBank:   DY847938.1 [3' end]
Protein sequence: CcinLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1089
PWM (Da):   %s   121723.19  
PI (pH):   %s   7.38
Sequence 1130
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSILRKLAQTVDYINESHAPVDTDGGRTQSGVYEKKVAALYQAFTNPPVTVDDLPAYVDAFLNSGGVGIDDRELLLEKLLTLMASTKDTSFSHKVQEAVISLLYKDLPHPPSGYLRVPPTTAPAPPLDVKYAYRTSDGSHYNPLAPAMGMAGTPYARSVPSRHTLPKESLPDPDLIFDTLLKREKFVPHPGGMSALFFAFADLVIHSIFKTNPHDWSINDASSYLDLSVLYGHSDRDVNAIRRKDGTGRLWNDVFADYRITHMPPASCALLVLLSRNHNYVAEKILDINESGKYTRTFANNAARDAQDDEIFHRARLVNCGYFMHIILGDYVGAILGLVRDGSDWRLDPMMTMRSRNHDFVPVGEGNVVSTEFNLLYRWHATLSDEDTKWTESLFQKMFSGKDPKDIKIDDFKEAAHKHLVLNIENVREWTFDGLKRGADGRFSDDDLARIIQNSTEYRAGAFKARGIPEALRFIEVMGIRQARTWGVCSLNEFRRFMGLKPYADFKQWNPDPKIYNAAQALYRDIENLELHVGLQAEETKEPGEGAGLCPGYTISRAILADAVCLTRGDRFFTVDYTPQNLTSWGFQDCAYDKQDGSFGGLLTKLLLRTLPNHYSRGNAYAHFPFMVPTFLEEHWKVHKPELVGKYTWTRPRQQPTIVPVGDYEIVTKVFADNSAFLSAYETRTLNAVKATLEKSVRRTLTLRGKRVSQAPGGSTTDKRLTQGRDEINTQILALPLSTYFSSKTKELIKAKGFTSADGSTAYVDIVRDVINLLPVHFVSQRIAGLPLKSDSTPKGVWYEQDMYDWFTDIAEYVYLNFQPEHDWRLRESTQLHGEEIIGYIKSHIDSIKNKFSLPDVRNHIAIGHNGHDFLTRIVDSLRNTDTSNRETAARIFAAVVPTAAIYASALSQIVSFFLQPSNASAAEALVSLPKSKDTATATTEVLGYIREALRLNPAIPGFYRTAARDVVLGPKTIQAYEVVYGSLYSANRDPQVFGPNPEVPVFNRQGKGAVLGLPNTGLTTEEFLAATVPAVLSEIMSLKGVKKAANKSGRFNEFQENWHGYPRKQYINAKGAVSSFPDSLILQYQVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns) and 2 ESTs (DY849051). Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTCCATCCTTCGCAAGCTCGCCCAGACCGTGGACTACATCAACGAGTCCCATGCACCCGTCGACACCGACGGCGGGCGCACACAGAGCGGCGTCTACGAAAAGAAGGTCGCTGCCC
TCTACCAGGCCTTCACTAATCCACCCGTCACTGTGGATGATTTG
GTGTGTACACATTCCTGCACGACGCCCACGAACCCCACTAACAGTGTCGTCCGACCGCAGCCCGCCTATGTCGATG
CTTTCCTCAACTCGGGTGGTGTGGGCATTGACGATCGAGAGCTTCTG
GTAATCAAAACCCTATTCTACAGTCGCCACAGGGACTAACGTGATCCTAGCTCGAGAAGCTGTTGACGCTTAT
GGCCAGTACGAAGGATACATCGTTCTCCCATAAGGTGCAAGAGGCCGTCATCAGCCTAC
GTACGTCCGCCCTCCGCGCCCTCCGCCGCCAATATCTATACTCATACCCCATCAAGTGTAC
AAGGATCTACCTCACCCTCCTAGCGGCTACCTTCGTGTACCACCCACTACCGCCCCTGCTCCTCCCCTCGACGTGAAGTATGCCTACCGGACATCTGACGGGTCGCATTACAACCCTTTG
GCCCCGGCAATGGGCATGGCAGGGACTCCCTACGCACGTTCGGTGCCCTCTCGGCACACCCTGCCCAAGGAATCACTCCCGGACCCTGACCTCATTTTTGACACGCTCCTCAAGCGCGAG
AAGTTCGTCCCCCATCCGGGAGGCATGTCCGCACTCTTCTTCGCCTTTGCCGACCTCGTCATTCACAGCATCTTCAAAACCAACCCTCATGACTGGTCAATCAATGATGCTAGTAGTTAC
CTCGACCTCAGCGTGCTCTATGGGCACAGCGACCGGGACGTCAATGCTATCAGGCGAAAGGACGGCACGGGTCGTCTGTGGAATGATGTATTCGCGGATTACAGGATCACCCATATGCCT
CCTGCGAGCTGCGCCTTGTTGGTGCTGTTAAGCAGGAATCATAAC
GTCAGTTCATTCAACCAGGATCCCCGTTTCTTCAAATGAAGCTCACTTCTTCCTCTCCATATAGTACGTCGCCGA
GAAGATCCTGGATATCAACGAAAGTGGGAAGTACACCCGAACATTTGCCAACAATGCCGCTCGCGACGCACAGGACGACGAGATCTTCCACCGAGCCCGTCTTGTCAACTGTGGATACTT
CATGCACATCATTCTCGGAG
GTACATTGCCATCCACCCTAGTCCTACGTGCGTATACTAAGATGTTATCCCCGTCAATTTTTAGACTACGTTGGCGCTATTCTGGGACTTGTGCGGGATG
GCAGTGACTGGCGCTTAGATCCCATGATG
GTCAGTGATGCAGTACGCCACGACTCCTGCGTAACCATCTAACCGCCTCTTCATCTGTTTCAGACTATGCGCAGCCGGAACCACGATTTCG
TACCCGTCGGAGAGGGCAACGTCGTCTCGACCGAGTTCAACCTTCTCTATCGCTGGCATGCAACCTTGTCAGACGAGGACACCAAATGGACGGAATCCCTCTTCCAGAAGATGTTCAGCG
GCAAGGACCCCAAGGACATCAAGATTGACGACTTCAAAGAGGCGGCCCACAAGCACTTGGTGCTCAACATTGAGAACGTCCGCGAATGGACGTTCGATGGGCTTAAGCGTGGTGCAGATG
GTCGATTCAGCGATGATGACCTCGCTCGCATCATCCAGAACTCGACTGAATACCGCGCTGGTGCTTTCAAGGCCCGTGGTATTCCAGAAGCCTTGCGCTTCATCGAAGTCATGGGCATCA
GGCAGGCTCGCACTTGGGGAGTGTGCTCCCTAAATGAGTTCAGAAGGTTCATGGGTCTTAAAC
GTAAGTCTCTGCTCCCAGTTCCTTCTGGCTCTTCTACTCACATTTGGTAACTCATAT
CCAGCGTACGCCGACTTCAAGCAGTGGAATCCCGACCCCAAGATCTACGTACGTCGTTTCTTTCTGTTGAAGCCCCTTCTCGCTAACCCTTTTTGTATGGAAATAGAATGCTGCCCAAGC
GCTCTATCGTGATATCGAGAACCTCGAATTGCACGTCGGCCTCCAGGCTGAAGAGACCAAAGAACCCGGAGAAGGTGCAGGTCTCTGCCCTGGCTACACCATCTCCCGTGCCATTCTCGC
CGATGCCGTCTGCCTCACCCGTGGAGATCGCTTCTTCACCGTCGATTACACGCCCCAGAACCTCACTTCATGGGGCTTCCAGGACTGCGCTTACGACAAGCAAGATGGTTCCTTCGGCGG
CCTCCTCACCAAACTCCTCCTCCGCACTCTCCCGAATCACTACTCGCGAGGAAATGCCTACGCTCACTTCCCCTTCATGGTTCCTACTTTCTTGGAGGAACATTGGAAGGTGCATAAACC
CGAGTTGGTTGGAAAATATACTTGGACCAGGCCTAGGCAGCAGCCCACGATTGTGCCTGTTGGAGACTACGAGATCGTCACCAAAGTTTTCGCTGACAACTCGGCCTTCCTCTCCGCGTA
CGAAACGCGTACCCTCAATGCCGTCAAAGCTACCCTCGAGAAATCTGTGCGCCGTACCCTAACACTCAGGGGAAAGCGTGTCTCCCAAGCCCCTGGAGGCTCGACTACCGATAAACGGCT
CACACAAGGCCGAGACGAGATCAACACCCAGATCCTCGCCCTCCCTCTCTCCACCTACTTCTCGTCCAAAACGAAGGAGCTCATCAAAGCCAAAGGATTCACCAGCGCGGATGGGTCCAC
TGCCTACGTAGACATTGTGCGTGATGTCATCAACCTCCTCCCAGTGCATTTCGTCTCGCAGCGGATTGCTGGCTTGCCGTTGAAGTCGGATTCGACGCCGAAGGGAGTGTGGTATGAGCA
AGATATGTATGATTGGTTCACGGATATCGCGGAGTATGTGTACTTGAACTTCCAACCGGAGCATGACTGGCGATTGAGGGAGTCGACGCAACTGCACGGGGAGGAGATTATTGGATACAT
CAAGTCCCACATTGACAGTATCAAGAACAAG
GTATGTCACTCCTTTGGCCCCCTTCCCTGGTCTTTCGCTCAATTCTGGCCTTTCTCTAGTTCTCTCTTCCCGATGTGCGCAACCACATT
GCAATTGGTCACAATGGCCACGACTTCTTGACCAGGATCGTCGACAGCCTGCGCAACACCGACACATCCAACCGTGAAACGGCAGCACGCATCTTCGCAGCCGTCGTCCCCACCGCCGCC
ATCTACGCCTCCGCACTCTCGCAGATCGTCTCATTCTTCCTCCAGCCTTCCAACGCCTCAGCTGCCGAAGCTCTCGTCTCCCTCCCCAAGTCCAAAGACACTGCTACCGCCACGACAGAA
GTGTTGGGTTACATCCGGGAAGCTCTCCGTCTGAACCCTGCCATTCCAGGGTTCTACAGGACCGCCGCACGCGATGTCGTGCTCGGGCCCAAGACGATCCAAGCCTACGAGGTCGTCTAT
GGAAGTCTGTACTCCGCCAACCGCGATCCCCAGGTCTTCGGACCTAACCCTGAGGTCCCCGTTTTCAATCGCCAAGGGAAAGGAGCGGTCTTGGGTCTCCCCAACACGGGTCTGACGACG
GAGGAGTTCTTGGCTGCTACTGTCCCAGCCGTGCTTTCTGAGATCATGTCGCTGAAGGGGGTGAAGAAGGCCGCTAACAAGAGTGGAAGGTTCAATGAATTCCAGGAGAACTGGCATGGG
TACCCCAGGAAGCAGTATATCAACGCGAAGGGAGCTGTTTCGTCATTCCCGGATTCGCTGATTCTGCAGTACCAGGTTGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTCCATCCTTCGCAAGCTCGCCCAGACCGTGGACTACATCAACGAGTCCCATGCACCCGTCGACACCGACGGCGGGCGCACACAGAGCGGCGTCTACGAAAAGAAGGTCGCTGCCC
TCTACCAGGCCTTCACTAATCCACCCGTCACTGTGGATGATTTG
CCCGCCTATGTCGATGCTTTCCTCAACTCGGGTGGTGTGGGCATTGACGATCGAGAGCTTCTGCTCGAGAAGCTGT
TGACGCTTATGGCCAGTACGAAGGATACATCGTTCTCCCATAAGGTGCAAGAGGCCGTCATCAGCCTAC
TGTACAAGGATCTACCTCACCCTCCTAGCGGCTACCTTCGTGTACCACCCA
CTACCGCCCCTGCTCCTCCCCTCGACGTGAAGTATGCCTACCGGACATCTGACGGGTCGCATTACAACCCTTTGGCCCCGGCAATGGGCATGGCAGGGACTCCCTACGCACGTTCGGTGC
CCTCTCGGCACACCCTGCCCAAGGAATCACTCCCGGACCCTGACCTCATTTTTGACACGCTCCTCAAGCGCGAGAAGTTCGTCCCCCATCCGGGAGGCATGTCCGCACTCTTCTTCGCCT
TTGCCGACCTCGTCATTCACAGCATCTTCAAAACCAACCCTCATGACTGGTCAATCAATGATGCTAGTAGTTACCTCGACCTCAGCGTGCTCTATGGGCACAGCGACCGGGACGTCAATG
CTATCAGGCGAAAGGACGGCACGGGTCGTCTGTGGAATGATGTATTCGCGGATTACAGGATCACCCATATGCCTCCTGCGAGCTGCGCCTTGTTGGTGCTGTTAAGCAGGAATCATAAC
T
ACGTCGCCGAGAAGATCCTGGATATCAACGAAAGTGGGAAGTACACCCGAACATTTGCCAACAATGCCGCTCGCGACGCACAGGACGACGAGATCTTCCACCGAGCCCGTCTTGTCAACT
GTGGATACTTCATGCACATCATTCTCGGAG
ACTACGTTGGCGCTATTCTGGGACTTGTGCGGGATGGCAGTGACTGGCGCTTAGATCCCATGATGACTATGCGCAGCCGGAACCACGATT
TCGTACCCGTCGGAGAGGGCAACGTCGTCTCGACCGAGTTCAACCTTCTCTATCGCTGGCATGCAACCTTGTCAGACGAGGACACCAAATGGACGGAATCCCTCTTCCAGAAGATGTTCA
GCGGCAAGGACCCCAAGGACATCAAGATTGACGACTTCAAAGAGGCGGCCCACAAGCACTTGGTGCTCAACATTGAGAACGTCCGCGAATGGACGTTCGATGGGCTTAAGCGTGGTGCAG
ATGGTCGATTCAGCGATGATGACCTCGCTCGCATCATCCAGAACTCGACTGAATACCGCGCTGGTGCTTTCAAGGCCCGTGGTATTCCAGAAGCCTTGCGCTTCATCGAAGTCATGGGCA
TCAGGCAGGCTCGCACTTGGGGAGTGTGCTCCCTAAATGAGTTCAGAAGGTTCATGGGTCTTAAAC
CGTACGCCGACTTCAAGCAGTGGAATCCCGACCCCAAGATCTACAATGCTGCCC
AAGCGCTCTATCGTGATATCGAGAACCTCGAATTGCACGTCGGCCTCCAGGCTGAAGAGACCAAAGAACCCGGAGAAGGTGCAGGTCTCTGCCCTGGCTACACCATCTCCCGTGCCATTC
TCGCCGATGCCGTCTGCCTCACCCGTGGAGATCGCTTCTTCACCGTCGATTACACGCCCCAGAACCTCACTTCATGGGGCTTCCAGGACTGCGCTTACGACAAGCAAGATGGTTCCTTCG
GCGGCCTCCTCACCAAACTCCTCCTCCGCACTCTCCCGAATCACTACTCGCGAGGAAATGCCTACGCTCACTTCCCCTTCATGGTTCCTACTTTCTTGGAGGAACATTGGAAGGTGCATA
AACCCGAGTTGGTTGGAAAATATACTTGGACCAGGCCTAGGCAGCAGCCCACGATTGTGCCTGTTGGAGACTACGAGATCGTCACCAAAGTTTTCGCTGACAACTCGGCCTTCCTCTCCG
CGTACGAAACGCGTACCCTCAATGCCGTCAAAGCTACCCTCGAGAAATCTGTGCGCCGTACCCTAACACTCAGGGGAAAGCGTGTCTCCCAAGCCCCTGGAGGCTCGACTACCGATAAAC
GGCTCACACAAGGCCGAGACGAGATCAACACCCAGATCCTCGCCCTCCCTCTCTCCACCTACTTCTCGTCCAAAACGAAGGAGCTCATCAAAGCCAAAGGATTCACCAGCGCGGATGGGT
CCACTGCCTACGTAGACATTGTGCGTGATGTCATCAACCTCCTCCCAGTGCATTTCGTCTCGCAGCGGATTGCTGGCTTGCCGTTGAAGTCGGATTCGACGCCGAAGGGAGTGTGGTATG
AGCAAGATATGTATGATTGGTTCACGGATATCGCGGAGTATGTGTACTTGAACTTCCAACCGGAGCATGACTGGCGATTGAGGGAGTCGACGCAACTGCACGGGGAGGAGATTATTGGAT
ACATCAAGTCCCACATTGACAGTATCAAGAACAAG
TTCTCTCTTCCCGATGTGCGCAACCACATTGCAATTGGTCACAATGGCCACGACTTCTTGACCAGGATCGTCGACAGCCTGCGCA
ACACCGACACATCCAACCGTGAAACGGCAGCACGCATCTTCGCAGCCGTCGTCCCCACCGCCGCCATCTACGCCTCCGCACTCTCGCAGATCGTCTCATTCTTCCTCCAGCCTTCCAACG
CCTCAGCTGCCGAAGCTCTCGTCTCCCTCCCCAAGTCCAAAGACACTGCTACCGCCACGACAGAAGTGTTGGGTTACATCCGGGAAGCTCTCCGTCTGAACCCTGCCATTCCAGGGTTCT
ACAGGACCGCCGCACGCGATGTCGTGCTCGGGCCCAAGACGATCCAAGCCTACGAGGTCGTCTATGGAAGTCTGTACTCCGCCAACCGCGATCCCCAGGTCTTCGGACCTAACCCTGAGG
TCCCCGTTTTCAATCGCCAAGGGAAAGGAGCGGTCTTGGGTCTCCCCAACACGGGTCTGACGACGGAGGAGTTCTTGGCTGCTACTGTCCCAGCCGTGCTTTCTGAGATCATGTCGCTGA
AGGGGGTGAAGAAGGCCGCTAACAAGAGTGGAAGGTTCAATGAATTCCAGGAGAACTGGCATGGGTACCCCAGGAAGCAGTATATCAACGCGAAGGGAGCTGTTTCGTCATTCCCGGATT
CGCTGATTCTGCAGTACCAGGTTGCGTGA

Retrieve as FASTA