Entry information : ZmPrx122
Entry ID 6683
Creation 2009-04-09 (Christophe Dunand)
Last sequence changes 2009-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx122
Name ZmPrx122
Class Class III peroxidase    [Orthogroup: Prx249]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx122
start..stop
S start..stop
SbPrx76 427 7e-152 2..316 3..321
SiPrx79 359 7e-125 1..314 1..316
SbPrx77 306 6e-104 1..315 1..323
BdiPrx131 303 8e-103 11..315 5..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 145337684..145337926 243 N° 2 145338098..145338295 198 N° 3 145338387..145338899 513  
join(145337684..145337926,145338098..145338295,145338387..145338899)


exon

Literature and cross-references ZmPrx122
DNA ref. GenBank:   AC191582.3 (176326..177541)
Protein sequence: ZmPrx122
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (289)
PWM (Da):   %s   34232.36 (31329.9) Transmb domain:   %s   i13-30o
PI (pH):   %s   7.31 (6.74) Peptide Signal:   %s   cut: 29 range:29-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTITTGGRHYFLLVAFSLLSSAAYGQLSQEYYASNCPSLDQIIKAEVDRTLFTDQPPAGGRRMGASLLRLFFHDCFVQGCDASVLLDDDLTKLIVSEKKAAPNDKSLRGFDVINRIKGEVEKACPAVVSCADILALVAKQAVISLGGQGWPLLLGRRDSTTASMVQASTDLPSPNSDLPTLIAAFDKKKLTAREMVALSGAHSIGLAQCANADKTTQQQRCSNANSNSLLPLDVQTPEGFDNLYYGNLPNKGLLHSDRVLTDRADLRDLVRQYASNQTLFFVDFASAMKKMSEMSLLTGANGEIRLNCTRVNYN*

Retrieve as FASTA  
Remarks Complete sequence from geneomic (chromo 5, introns 1 and 2). No EST. Also found in AC15581.2.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATCCACTATTACCACCGGCGGCCGCCATTATTTCTTGCTTGTTGCGTTTTCTCTCCTCTCCTCGGCCGCCTACGGGCAGCTCTCGCAAGAATACTACGCCTCAAACTGCCCG
TCGCTGGATCAAATCATTAAAGCGGAGGTGGATCGTACCTTGTTCACCGATCAACCACCTGCCGGCGGACGCCGGATGGGCGCGTCCCTCCTCAGGCTCTTCTTCCACGACTGCTTCGTT
CAG
GTATTTTATCTTGCAAGTATTATTACTGATTAGATCGAGACTTTAATAGACGTTATTTTTTTTATAATTAAGGTGTGTTAGATAACAATAAACAATACAAATTCTCAAAAGCAATTA
TTACCCACTCTATTAACAAACACATGTCACTCTCTTGTCGTGTGCTGTGTGCAGGGCTGCGATGCCTCGGTTCTCCTGGACGACGACTTGACGAAGTTAATCGTAAGCGAGAAGAAGGCT
GCCCCGAACGACAAGTCCCTACGCGGCTTCGACGTGATCAACCGGATCAAGGGTGAAGTCGAGAAAGCCTGCCCCGCCGTCGTCTCCTGCGCCGACATCCTCGCCCTCGTTGCCAAGCAA
GCCGTCATCTCC
GTACGTAACCCGCGATAATATGCTGCATGCATTGGCAGTGATATCATAATAATATACTCTATACATGTGCATGCGCTATATATATATGCAGCTCGGGGGACAAGGATG
GCCGCTGTTACTCGGCCGGCGCGACTCCACGACGGCGAGCATGGTGCAAGCAAGCACCGATCTCCCGTCCCCGAACTCAGACCTGCCCACGCTGATCGCGGCGTTCGACAAGAAGAAGCT
CACGGCTAGGGAGATGGTGGCGCTGTCCGGCGCGCACAGCATCGGCCTGGCGCAGTGCGCCAACGCCGACAAGACGACCCAGCAGCAGAGGTGCAGCAACGCCAACAGTAACAGCCTCCT
CCCGCTCGACGTGCAGACGCCCGAGGGCTTCGACAACCTGTACTACGGGAACCTGCCGAACAAAGGCCTGCTGCACTCCGACCGCGTGCTCACGGACCGCGCCGACCTCAGGGACCTCGT
GCGGCAGTACGCGTCCAACCAGACCCTTTTCTTCGTGGACTTCGCCAGCGCGATGAAGAAGATGTCGGAGATGAGCTTGCTCACCGGAGCTAATGGCGAGATCAGGCTCAACTGCACTAG
GGTCAACTACAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATCCACTATTACCACCGGCGGCCGCCATTATTTCTTGCTTGTTGCGTTTTCTCTCCTCTCCTCGGCCGCCTACGGGCAGCTCTCGCAAGAATACTACGCCTCAAACTGCCCG
TCGCTGGATCAAATCATTAAAGCGGAGGTGGATCGTACCTTGTTCACCGATCAACCACCTGCCGGCGGACGCCGGATGGGCGCGTCCCTCCTCAGGCTCTTCTTCCACGACTGCTTCGTT
CAG
GGCTGCGATGCCTCGGTTCTCCTGGACGACGACTTGACGAAGTTAATCGTAAGCGAGAAGAAGGCTGCCCCGAACGACAAGTCCCTACGCGGCTTCGACGTGATCAACCGGATCAAG
GGTGAAGTCGAGAAAGCCTGCCCCGCCGTCGTCTCCTGCGCCGACATCCTCGCCCTCGTTGCCAAGCAAGCCGTCATCTCC
CTCGGGGGACAAGGATGGCCGCTGTTACTCGGCCGGCGC
GACTCCACGACGGCGAGCATGGTGCAAGCAAGCACCGATCTCCCGTCCCCGAACTCAGACCTGCCCACGCTGATCGCGGCGTTCGACAAGAAGAAGCTCACGGCTAGGGAGATGGTGGCG
CTGTCCGGCGCGCACAGCATCGGCCTGGCGCAGTGCGCCAACGCCGACAAGACGACCCAGCAGCAGAGGTGCAGCAACGCCAACAGTAACAGCCTCCTCCCGCTCGACGTGCAGACGCCC
GAGGGCTTCGACAACCTGTACTACGGGAACCTGCCGAACAAAGGCCTGCTGCACTCCGACCGCGTGCTCACGGACCGCGCCGACCTCAGGGACCTCGTGCGGCAGTACGCGTCCAACCAG
ACCCTTTTCTTCGTGGACTTCGCCAGCGCGATGAAGAAGATGTCGGAGATGAGCTTGCTCACCGGAGCTAATGGCGAGATCAGGCTCAACTGCACTAGGGTCAACTACAACTAA

Retrieve as FASTA