Entry information : ZmPrx128
Entry ID 6690
Creation 2009-04-10 (Christophe Dunand)
Last sequence changes 2009-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx128
Name ZmPrx128
Class Class III peroxidase    [Orthogroup: Prx079]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx128
start..stop
S start..stop
SbPrx110 587 0 3..338 1..334
SiPrx102 568 0 5..337 1..328
SiPrx106 548 0 9..336 3..324
OsPrx68 419 4e-148 41..338 38..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85745305..85745562 258 N° 2 85745807..85746565 759  
join(85745305..85745562,85745807..85746565)


exon

Literature and cross-references ZmPrx128
DNA ref. GenBank:   AC198787.3 (185578..186838)
Protein sequence: ZmPrx128
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (302)
PWM (Da):   %s   35688.69 (31757.7)  
PI (pH):   %s   7.92 (7.24) Peptide Signal:   %s   cut: 37 range:37-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMLMMTWTWTCNAKLLLMTLVFAAALSATVTTSRAQSPPLQYNFYGASCPQAEATVRNVTEGIIANDRTMGAAFMRLFFHDCFVRGCDASILLDPTSSNTQVEKKAIALRGYAAVNTIKAAVEAVCPGVVSCADILAFAARDTAVVSGGFAGFGMPSGRRDGVVSSFIEVLQNIPSPTFKLPDLVSNFAKKGLDVDDLVTLSAAHSFGQAHCSFVNGRLYPTVDPTMNATYAAGLKTVCPPPGSGGGDPVISNNRVTDPNALSNQFYSNLMTGQVLFVSDQQLMNTTYTAAKVANNSADSAAWMTQFQTALLKMGSIQVLTGTAGQVRKYCNVVNSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGCTGATGATGACGTGGACGTGGACATGCAACGCCAAGCTGCTGCTGATGACGCTCGTCTTCGCTGCTGCGCTGAGCGCGACGGTGACGACGTCGCGGGCGCAGTCGCCGCCG
CTGCAGTACAACTTCTACGGCGCGTCGTGCCCGCAGGCGGAGGCGACGGTCCGCAACGTCACCGAGGGGATCATCGCCAACGACCGCACCATGGGCGCCGCCTTCATGCGTCTCTTCTTC
CACGACTGCTTCGTCAGG
GTATGTATAGCTAGCAAAAAATTATATTGATCATCCTCGATTATCTTGCATTGATACTAAAGCTAGCTAGGACATTTTGATGCATGCATCACGTACGTACGT
ACACGTATATATAGTATGCTAACGATATATACTAGTAATACTGTCAACATCACGTACGTACGTACACGTATGAGCAGTACGTAGTAAACACTATATATAGTATGCTAACGATGCACGGCT
CCCCGGCGGCTTTAATTTGCAGGGCTGCGACGCCTCCATACTGCTGGACCCGACCAGCAGCAACACGCAGGTGGAGAAGAAGGCGATCGCGCTGCGCGGGTACGCGGCCGTGAACACGAT
CAAGGCGGCGGTGGAGGCGGTGTGCCCCGGGGTGGTCTCCTGCGCCGACATCCTGGCGTTCGCGGCGCGGGACACGGCCGTCGTCTCCGGCGGCTTCGCCGGCTTCGGCATGCCCTCGGG
CCGCCGCGACGGGGTGGTCTCCAGCTTCATCGAGGTGCTGCAGAACATCCCGTCCCCGACCTTCAAGCTCCCCGACCTCGTCAGCAACTTCGCCAAGAAGGGACTCGACGTGGACGACCT
CGTCACGCTCTCCGCCGCGCACTCCTTCGGCCAGGCGCACTGCTCCTTCGTCAACGGCCGCCTCTACCCCACCGTCGACCCCACCATGAACGCCACCTACGCCGCCGGGCTCAAGACGGT
GTGCCCGCCGCCTGGCAGCGGCGGCGGCGACCCGGTCATCAGCAACAACCGGGTCACGGACCCCAACGCGCTCAGCAACCAGTTCTACAGCAACCTGATGACCGGGCAGGTGCTCTTCGT
CTCGGACCAGCAGCTCATGAACACCACCTACACGGCGGCCAAGGTGGCCAACAACTCCGCCGATTCTGCCGCCTGGATGACCCAGTTCCAAACGGCGCTGCTCAAGATGGGCAGCATCCA
GGTGCTCACCGGGACGGCCGGCCAGGTCAGGAAGTACTGCAACGTCGTCAACAGCAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGCTGATGATGACGTGGACGTGGACATGCAACGCCAAGCTGCTGCTGATGACGCTCGTCTTCGCTGCTGCGCTGAGCGCGACGGTGACGACGTCGCGGGCGCAGTCGCCGCCG
CTGCAGTACAACTTCTACGGCGCGTCGTGCCCGCAGGCGGAGGCGACGGTCCGCAACGTCACCGAGGGGATCATCGCCAACGACCGCACCATGGGCGCCGCCTTCATGCGTCTCTTCTTC
CACGACTGCTTCGTCAGG
GGCTGCGACGCCTCCATACTGCTGGACCCGACCAGCAGCAACACGCAGGTGGAGAAGAAGGCGATCGCGCTGCGCGGGTACGCGGCCGTGAACACGATCAAG
GCGGCGGTGGAGGCGGTGTGCCCCGGGGTGGTCTCCTGCGCCGACATCCTGGCGTTCGCGGCGCGGGACACGGCCGTCGTCTCCGGCGGCTTCGCCGGCTTCGGCATGCCCTCGGGCCGC
CGCGACGGGGTGGTCTCCAGCTTCATCGAGGTGCTGCAGAACATCCCGTCCCCGACCTTCAAGCTCCCCGACCTCGTCAGCAACTTCGCCAAGAAGGGACTCGACGTGGACGACCTCGTC
ACGCTCTCCGCCGCGCACTCCTTCGGCCAGGCGCACTGCTCCTTCGTCAACGGCCGCCTCTACCCCACCGTCGACCCCACCATGAACGCCACCTACGCCGCCGGGCTCAAGACGGTGTGC
CCGCCGCCTGGCAGCGGCGGCGGCGACCCGGTCATCAGCAACAACCGGGTCACGGACCCCAACGCGCTCAGCAACCAGTTCTACAGCAACCTGATGACCGGGCAGGTGCTCTTCGTCTCG
GACCAGCAGCTCATGAACACCACCTACACGGCGGCCAAGGTGGCCAACAACTCCGCCGATTCTGCCGCCTGGATGACCCAGTTCCAAACGGCGCTGCTCAAGATGGGCAGCATCCAGGTG
CTCACCGGGACGGCCGGCCAGGTCAGGAAGTACTGCAACGTCGTCAACAGCAGCTAA

Retrieve as FASTA