Entry information : ZmPrx129
Entry ID 6691
Creation 2009-04-10 (Christophe Dunand)
Last sequence changes 2009-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx129
Name ZmPrx129
Class Class III peroxidase    [Orthogroup: Prx140]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx129
start..stop
S start..stop
SbPrx111 556 0 3..327 2..323
SbPrx109 553 0 1..327 1..323
SiPrx104 498 2e-179 22..327 22..323
SiPrx99 481 4e-173 22..327 20..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85754152..85754376 225 N° 2 85754516..85755274 759  
join(85754152..85754376,85754516..85755274)


exon

Literature and cross-references ZmPrx129
DNA ref. GenBank:   AC198787.3 (39495..38373)
Protein sequence: ZmPrx129
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   33609.58 (31264.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.24 (7.24) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAATSSAALVTMVVVIAAAAISTASGTALLQYNFYGSSCPKAEEAVRNATQKIISDDPTMGAAFVRLFFHDCFVRGCDASILLDQSNSNPQPEKLAIPLRGYAQVNTIKAAVEAVCPGVVSCADILAYAARDSAAASGGFAFAMPGGRRDGSVSNLNDIPGNLPAPNMQVQDLIASFGSKGLSAADLVALSGAHSFGQTHCSFVTPRLYPAVDATMNATFAAALKAVCPPPSQGGGGTVLNNNRVTDPNKLSNQYYTNLATGQVMFTSDQTLTSSNTTNKMVQDNAADPIAWMARFAGAMLKMGGIQVLTGTQGEIRRVCGATNGGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 10, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGACCTCGTCAGCCGCCTTAGTGACCATGGTGGTGGTGATCGCTGCAGCTGCGATCAGCACGGCTTCCGGCACGGCACTACTGCAGTACAACTTCTACGGCTCGTCGTGCCCA
AAAGCCGAGGAGGCGGTCCGCAACGCCACTCAGAAGATCATCTCCGACGACCCCACCATGGGCGCCGCCTTCGTGCGCCTCTTCTTCCATGACTGCTTCGTCAGG
GTAACAACCATCAGT
AGTTTCTCCTCCTCTAATTTTGTGGCATATATGTACGTACGTACACATGTACTTCTACATGAAACCCAGAAGCTCATGTGTATCAGTAATAATACAACTGACGACGACGGTTTCCATGTC
TCAGGGCTGCGACGCTTCCATCCTGCTCGACCAGTCCAACAGCAACCCGCAGCCGGAGAAGCTAGCCATCCCGCTACGCGGCTACGCGCAAGTGAACACGATCAAGGCGGCCGTGGAGGC
CGTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTCGCCTACGCGGCGCGCGACTCCGCGGCCGCCTCCGGCGGCTTCGCCTTCGCCATGCCGGGCGGCCGGCGCGACGGGTCCGTGTC
CAACCTCAACGACATTCCCGGGAACCTCCCTGCCCCGAACATGCAGGTCCAGGACCTCATCGCCAGCTTCGGCAGCAAGGGCCTCAGCGCCGCCGACCTGGTGGCGCTCTCCGGCGCGCA
CTCCTTCGGCCAGACGCACTGCTCCTTCGTCACGCCCCGGCTGTACCCCGCCGTGGACGCGACCATGAACGCCACCTTCGCCGCGGCGCTCAAGGCGGTGTGCCCGCCGCCTTCGCAAGG
CGGGGGCGGCACCGTGCTCAACAACAACCGTGTGACGGACCCCAACAAGCTGAGCAACCAGTATTACACCAACTTGGCCACCGGGCAGGTCATGTTCACGTCGGACCAGACGCTGACCAG
TAGCAACACCACCAACAAGATGGTGCAGGACAACGCTGCCGATCCGATCGCGTGGATGGCACGGTTCGCGGGGGCCATGCTGAAGATGGGAGGCATCCAGGTGCTCACCGGCACCCAGGG
TGAGATTAGAAGAGTCTGCGGCGCCACCAACGGCGGCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGACCTCGTCAGCCGCCTTAGTGACCATGGTGGTGGTGATCGCTGCAGCTGCGATCAGCACGGCTTCCGGCACGGCACTACTGCAGTACAACTTCTACGGCTCGTCGTGCCCA
AAAGCCGAGGAGGCGGTCCGCAACGCCACTCAGAAGATCATCTCCGACGACCCCACCATGGGCGCCGCCTTCGTGCGCCTCTTCTTCCATGACTGCTTCGTCAGG
GGCTGCGACGCTTCC
ATCCTGCTCGACCAGTCCAACAGCAACCCGCAGCCGGAGAAGCTAGCCATCCCGCTACGCGGCTACGCGCAAGTGAACACGATCAAGGCGGCCGTGGAGGCCGTCTGCCCCGGCGTCGTC
TCCTGCGCCGACATCCTCGCCTACGCGGCGCGCGACTCCGCGGCCGCCTCCGGCGGCTTCGCCTTCGCCATGCCGGGCGGCCGGCGCGACGGGTCCGTGTCCAACCTCAACGACATTCCC
GGGAACCTCCCTGCCCCGAACATGCAGGTCCAGGACCTCATCGCCAGCTTCGGCAGCAAGGGCCTCAGCGCCGCCGACCTGGTGGCGCTCTCCGGCGCGCACTCCTTCGGCCAGACGCAC
TGCTCCTTCGTCACGCCCCGGCTGTACCCCGCCGTGGACGCGACCATGAACGCCACCTTCGCCGCGGCGCTCAAGGCGGTGTGCCCGCCGCCTTCGCAAGGCGGGGGCGGCACCGTGCTC
AACAACAACCGTGTGACGGACCCCAACAAGCTGAGCAACCAGTATTACACCAACTTGGCCACCGGGCAGGTCATGTTCACGTCGGACCAGACGCTGACCAGTAGCAACACCACCAACAAG
ATGGTGCAGGACAACGCTGCCGATCCGATCGCGTGGATGGCACGGTTCGCGGGGGCCATGCTGAAGATGGGAGGCATCCAGGTGCTCACCGGCACCCAGGGTGAGATTAGAAGAGTCTGC
GGCGCCACCAACGGCGGCAACTAA

Retrieve as FASTA