Entry information : ZmPrx133
Entry ID 6695
Creation 2009-04-11 (Christophe Dunand)
Last sequence changes 2009-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx133
Name ZmPrx133
Class Class III peroxidase    [Orthogroup: Prx110]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx133
start..stop
S start..stop
SbPrx141 596 0 1..320 1..320
SiPrx36 525 0 21..320 19..318
SiPrx35 513 0 1..320 1..319
SbPrx142 506 0 9..320 6..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53240270..53240494 225 N° 2 53240559..53240756 198 N° 3 53240907..53241066 160 N° 4 53241196..53241575 380
join(53240270..53240494,53240559..53240756,53240907..53241066,53241196..53241575 )


exon

Literature and cross-references ZmPrx133
DNA ref. GenBank:   AC196709.3 (86995..85650)
Protein sequence: ZmPrx133
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (292)
PWM (Da):   %s   33925.48 (31290.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.49 (4.49) Peptide Signal:   %s   cut: 29 range:29-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASGGLSFVVVATLVIVSAGLMPPPAVAELATDYYASTCPNLEVIVRSSVKQSMAQSPISAPAALRLFFHDCAVRGCDASIMIVNSDGDDEWRNSDNQSLKPEGFQTILDAKAAVDSDPQCRYKVSCADIMAVAARESVYQSGGPYYEVELGRYDGRVSTRDGVVLPHANFDLDQLTAFFSSLGFTQAEMVALSGAHTIGAADCPFFQYRIGSDATMDPGLASQLNGTCSSDPNAFAFLDPSPVAFDNALYRNLQGGKGLLGSDQVLYSDPRSRGTVDYYASNQGAFFADFVAAMAKLGRVGVKTPATGGEIRRDCRFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTGGTGGGCTGAGCTTCGTCGTCGTCGCCACCCTCGTCATCGTGTCCGCGGGCCTCATGCCGCCGCCTGCCGTTGCCGAGCTGGCGACGGACTACTATGCCAGCACCTGCCCC
AACCTGGAGGTCATCGTCCGGAGCTCCGTGAAGCAGTCCATGGCGCAGTCACCCATCTCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GTACGTATTTACTAC
TACATTCGACGACGGCCGTACAGGTAGTGACCCAACATCATATACACAGGGCTGCGACGCGTCGATCATGATCGTGAACTCCGACGGCGACGACGAGTGGCGGAACAGCGACAACCAGTC
GCTCAAGCCGGAGGGGTTCCAGACCATCCTGGACGCCAAGGCTGCCGTGGACAGCGACCCGCAGTGCCGCTACAAGGTTTCCTGCGCCGACATCATGGCCGTAGCCGCCAGAGAATCCGT
CTACCAG
GTAGCAACAACAACTTAGCTTAACAGCTAGCCGCCGCCGCCGCCGGGGCGACGACGACAGAGAAATCACCTATATACATGCAAAACGCACAGCCGCCAGAGAGAAAGCCATTC
ATTTTCAGTTACACGCACGCACGCGTTGGTTTTCCAGAGCGGCGGACCCTACTACGAGGTGGAGCTGGGCCGTTACGACGGCCGGGTGTCCACCAGGGACGGCGTCGTGCTGCCGCACGC
CAACTTCGACCTCGACCAGCTCACCGCCTTCTTCTCCAGCCTCGGCTTCACCCAGGCCGAAATGGTCGCGCTGTCAG
GTAAAACCGTAAAAGACAGCACTGCACTGCATATTATTACACC
TCGACCTGCTCGATCTGGCATGAGCCTGAGTGCCTGACCACCGGCCGTCTGGCTCGATCTGGCTTTTCTGTGCGTTGATTATTCAGGCGCCCACACCATCGGCGCCGCGGACTGCCCTTT
CTTCCAGTACAGGATCGGCAGCGACGCGACCATGGACCCCGGCCTCGCGTCGCAGCTGAACGGCACCTGCAGCTCCGACCCCAACGCTTTCGCCTTCCTGGACCCCTCGCCCGTGGCCTT
CGACAACGCCCTGTACCGGAACCTGCAGGGCGGCAAGGGCCTCCTGGGCTCCGACCAGGTGCTCTACTCCGACCCGAGGTCGCGCGGCACGGTCGACTACTACGCGTCCAACCAGGGCGC
CTTCTTCGCCGACTTCGTGGCGGCGATGGCCAAGCTTGGGAGAGTCGGCGTCAAGACGCCGGCCACCGGCGGCGAGATACGCCGGGACTGCCGGTTCCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTGGTGGGCTGAGCTTCGTCGTCGTCGCCACCCTCGTCATCGTGTCCGCGGGCCTCATGCCGCCGCCTGCCGTTGCCGAGCTGGCGACGGACTACTATGCCAGCACCTGCCCC
AACCTGGAGGTCATCGTCCGGAGCTCCGTGAAGCAGTCCATGGCGCAGTCACCCATCTCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GGCTGCGACGCGTCG
ATCATGATCGTGAACTCCGACGGCGACGACGAGTGGCGGAACAGCGACAACCAGTCGCTCAAGCCGGAGGGGTTCCAGACCATCCTGGACGCCAAGGCTGCCGTGGACAGCGACCCGCAG
TGCCGCTACAAGGTTTCCTGCGCCGACATCATGGCCGTAGCCGCCAGAGAATCCGTCTACCAG
AGCGGCGGACCCTACTACGAGGTGGAGCTGGGCCGTTACGACGGCCGGGTGTCCACC
AGGGACGGCGTCGTGCTGCCGCACGCCAACTTCGACCTCGACCAGCTCACCGCCTTCTTCTCCAGCCTCGGCTTCACCCAGGCCGAAATGGTCGCGCTGTCAG
GCGCCCACACCATCGGC
GCCGCGGACTGCCCTTTCTTCCAGTACAGGATCGGCAGCGACGCGACCATGGACCCCGGCCTCGCGTCGCAGCTGAACGGCACCTGCAGCTCCGACCCCAACGCTTTCGCCTTCCTGGAC
CCCTCGCCCGTGGCCTTCGACAACGCCCTGTACCGGAACCTGCAGGGCGGCAAGGGCCTCCTGGGCTCCGACCAGGTGCTCTACTCCGACCCGAGGTCGCGCGGCACGGTCGACTACTAC
GCGTCCAACCAGGGCGCCTTCTTCGCCGACTTCGTGGCGGCGATGGCCAAGCTTGGGAGAGTCGGCGTCAAGACGCCGGCCACCGGCGGCGAGATACGCCGGGACTGCCGGTTCCCCAAC
TAG

Retrieve as FASTA