Entry information : ZmPrx141 (GRMZM2G047656)
Entry ID 6703
Creation 2009-04-11 (Christophe Dunand)
Last sequence changes 2009-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx141 (GRMZM2G047656)
Name (synonym) ZmPrx141 (GRMZM2G047656)
Class Class III peroxidase    [Orthogroup: Prx113]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx141
start..stop
S start..stop
SbPrx03 561 0 12..332 15..334
ZmPrx108 538 0 26..332 22..328
ZmPrx108_35A19 538 0 26..332 24..330
SiPrx160 533 0 24..332 19..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 279559119..279559349 231 N° 2 279559451..279559645 195 N° 3 279559772..279559937 166 N° 4 279560066..279560472 407
join(279559119..279559349,279559451..279559645,279559772..279559937,279560066..2 79560472)


exon

Literature and cross-references ZmPrx141 (GRMZM2G047656)
DNA ref. GenBank:   AC186424.4 (51053..52406)
Protein sequence: ZmPrx141 (GRMZM2G047656)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (307)
PWM (Da):   %s   34812.56 (32471.2)  
PI (pH):   %s   7.36 (6.98) Peptide Signal:   %s   cut: 26 range:26-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPSAGKALPLVVVLAVAVVASLAQPGAADLRPNYYASSCPNVEAIVRGVVQQRLQATIRTVGSTVRLFFHDCFVEGCDGSVLIESTPRNQAEKDAPDNRSLAPEGFDTVRSAKAAVEAACPDTVSCADVLALATRDAIFMSGGPFFQVELGRLDGLSSTASSVPGQLPEPNQSMDQLLAVFNAHGLGMSDLVALSAAHSVGLAHCSKFASRLYSFRPGQPTDPTLNPRYASFLASKCPNGGGADSLVLMDQATPSRFDNQYYRNLQDGGGLLASDQLLYADGRTRPAVDSLANSTAAFHRAFADAIVRLGRVGAKSSARGNIRKRCDVFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No EST. Also found in AC177884.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGCCGTCGGCAGGCAAGGCGTTGCCGCTGGTCGTCGTCCTCGCGGTCGCCGTGGTCGCGTCCCTTGCGCAGCCCGGCGCGGCCGACCTGAGGCCGAACTACTACGCGAGCAGT
TGCCCCAACGTGGAGGCCATCGTGCGCGGCGTGGTGCAGCAGCGGCTGCAGGCCACCATCCGCACCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GTCCGTTCC
GTCGTTCCGACCAGCTTCATTCTGTACGCCCGGCCGTTTCCCACAGCGTGTAGTGACGAACCGGTGGTACGTACGTACGTATACGCGCGCAGGGCTGCGACGGCTCGGTGCTGATCGAAT
CGACGCCCCGCAACCAGGCCGAGAAGGACGCCCCCGACAACAGGTCCCTCGCGCCCGAAGGCTTCGACACCGTGCGGAGCGCCAAGGCCGCCGTCGAGGCCGCCTGCCCGGACACCGTCT
CCTGCGCCGACGTGCTCGCCCTCGCCACTCGGGACGCCATCTTCATG
GTACTTTAATTAAGCTTCCGTTGGAGCTACACTATATATACATGCCCGCTGCATGCCTTCCAGCCCAGCAGGC
ACGCACGATACATCATCGTATAATAACCACCGCCGTACCTATCGTGCATGCAGAGCGGCGGGCCTTTCTTCCAGGTGGAGCTGGGCAGGCTGGACGGCCTGAGCTCCACGGCCAGCAGCG
TGCCGGGGCAGCTGCCGGAGCCCAACCAGAGCATGGACCAGCTGCTGGCGGTCTTCAACGCACACGGGCTCGGCATGTCCGACCTCGTCGCGCTCTCAG
GTCCGATCCGCCGTGCATGTG
CACCAGCGTCAGCCGTCAGACACATGCATTAATTAACTTGTACATGCGTGAATCAGCCATGGAACTTAATGTTTGACAATGTGCGTGCGTGGTGACCGATCGAGCAGCGGCGCACAGCGT
GGGGCTGGCGCACTGCAGCAAGTTCGCGAGCCGGCTGTACAGCTTCCGGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCCGCTACGCGAGCTTCCTGGCGAGCAAGTGCCCCAACGG
CGGCGGGGCCGACAGCCTGGTGCTCATGGACCAGGCCACGCCCTCGCGCTTCGACAACCAGTACTACCGCAACCTCCAGGACGGCGGCGGCCTGCTGGCCTCCGACCAGCTGCTCTACGC
CGACGGCCGCACGCGCCCCGCGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCCACCGTGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGCCAAGTCCAGCGCGCGGGG
CAACATCCGCAAGCGGTGCGACGTGTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGCCGTCGGCAGGCAAGGCGTTGCCGCTGGTCGTCGTCCTCGCGGTCGCCGTGGTCGCGTCCCTTGCGCAGCCCGGCGCGGCCGACCTGAGGCCGAACTACTACGCGAGCAGT
TGCCCCAACGTGGAGGCCATCGTGCGCGGCGTGGTGCAGCAGCGGCTGCAGGCCACCATCCGCACCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GGCTGCGAC
GGCTCGGTGCTGATCGAATCGACGCCCCGCAACCAGGCCGAGAAGGACGCCCCCGACAACAGGTCCCTCGCGCCCGAAGGCTTCGACACCGTGCGGAGCGCCAAGGCCGCCGTCGAGGCC
GCCTGCCCGGACACCGTCTCCTGCGCCGACGTGCTCGCCCTCGCCACTCGGGACGCCATCTTCATG
AGCGGCGGGCCTTTCTTCCAGGTGGAGCTGGGCAGGCTGGACGGCCTGAGCTCC
ACGGCCAGCAGCGTGCCGGGGCAGCTGCCGGAGCCCAACCAGAGCATGGACCAGCTGCTGGCGGTCTTCAACGCACACGGGCTCGGCATGTCCGACCTCGTCGCGCTCTCAG
CGGCGCAC
AGCGTGGGGCTGGCGCACTGCAGCAAGTTCGCGAGCCGGCTGTACAGCTTCCGGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCCGCTACGCGAGCTTCCTGGCGAGCAAGTGCCCC
AACGGCGGCGGGGCCGACAGCCTGGTGCTCATGGACCAGGCCACGCCCTCGCGCTTCGACAACCAGTACTACCGCAACCTCCAGGACGGCGGCGGCCTGCTGGCCTCCGACCAGCTGCTC
TACGCCGACGGCCGCACGCGCCCCGCGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCCACCGTGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGCCAAGTCCAGCGCG
CGGGGCAACATCCGCAAGCGGTGCGACGTGTTCAACTGA

Retrieve as FASTA