Entry information : ZmAPx10 (GRMZM2G156227 [6a])
Entry ID 6708
Creation 2009-04-14 (Christophe Dunand)
Last sequence changes 2009-04-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-07-01 (Christophe Dunand)
Peroxidase information: ZmAPx10 (GRMZM2G156227 [6a])
Name (synonym) ZmAPx10 (GRMZM2G156227 [6a])
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx10
start..stop
S start..stop
SbAPx09 688 0 1..351 1..351
SiAPx04 628 0 1..351 1..353
OsAPx10 566 0 1..351 1..348
BdiAPx08 534 0 1..351 11..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12105076..12105171 96 N° 2 12104864..12104980 117 N° 3 12104573..12104657 85 N° 4 12104439..12104473 35
N° 5 12104286..12104351 66 N° 6 12104166..12104205 40 N° 7 12103870..12103995 126 N° 8 12103645..12103751 107
N° 9 12103372..12103509 138 N° 10 12103123..12103257 135 N° 11 12102937..12103047 111  
complement(join(12102937..12103047,12103123..12103257,12103372..12103509,1210364 5..12103751,12103870..12103995,12104166..12104205,12104286..12104351,12104439..1 2104473,12104573..12104657,12104864..12104980,12105076..12105171))


exon

Literature and cross-references ZmAPx10 (GRMZM2G156227 [6a])
Protein ref. UniProtKB:   B4FS17
DNA ref. GenBank:   AC191302.2 (9431..11662)
mRNA ref. GenBank:   BT039905
Cluster/Prediction ref. UniGene:   Zm.82216
Protein sequence: ZmAPx10 (GRMZM2G156227 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (332)
PWM (Da):   %s   38228.46 (36456.5)  
PI (pH):   %s   8.34 (8.09) Peptide Signal:   %s   cut: 20 range:20-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGANFLSTAALVARGVAACSSISTPTRRHPQIRVCCRADVEAMEAYAHEERLRFRRRDFIGTCVGTAIGLEMIDGSTSFSGVATAADLIERRQRSEFQSKIKDTLYVAIAKPELVPSLLTMALNDAMTYDKTTKTGGANGSIRLETSRPENSGLSSALDLLTEAKKEIDSFSKGGPISFADLIQFAAQSALKRSFLDAAIAKCGGNEEKGRTLYSAYGSNGWGLFDRTFGRADAQEADPEGRVPDWSKASVQEMKDRFVAVGLGPRQLAVMSAFLGPDQAATEGRLIADPDCRPWVEKYQRSRETVSRTDYEVDLITTLTKLSSLGQKINYEAYTYPKQKIDLGKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 11 introns), 3 mRNA and 76 ESTs. Strain="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGAGCGAACTTCCTCTCCACCGCGGCGCTCGTCGCCCGCGGCGTCGCTGCCTGCTCTTCTATTTCAACTCCGACACGGAGGCACCCGCAAGTACGTTACGTTCGCCCCCTGAAC
TTACTGGTTTGCCTGTGCAGGTTCCATTTCAAACCCGAGGGAACCGCGTGATTCTTGGTTTGCCTCTGCAGATCCGGGTGTGCTGCCGGGCTGACGTTGAGGCTATGGAGGCCTATGCCC
ATGAAGAGCGCCTTCGATTCCGTCGGAGAGATTTCATCGGCACCTGCGTCGGCACCGCTATTGGTTTG
GTACGTGTCAGTGCTACCATTTTATTTTATTTTTTTTTGATAAAAAGATCAA
TGCCCTTTGTGCATTGGTGCCATCGAAGTAAACAAATGTAGCATGATGGGAGAGCATCAAGTTGTTGCCCCAGCAAACTTTTCTGAGAAAACGCACCTTTTGTTTCAGTTCAGAGGTGAT
AAAGTGAACTTCGTTTATTTATGTCTTGGGTTAGGAAATGATCGACGGCTCTACGAGTTTCTCTGGAGTGGCTACTGCAGCTGATCTCATTGAGCGTAGACAAAGGTCGGAGTTCCAATG
TAGGTCAACTCGTATTGTTATTTCCATTGCTCCCCCCTTGAAAATGCTATGTTTTATTCTCACCATCAAAATTGAAGTATTTTGACTGTTTTTTGCAGCAAAAATCAAAGACACCCTTTA
CGTAGCCATAAAG
GTGAGACACCCTAGTTCCTTGTGTTTTCCTTTCACCTATCTATCACTCTCTGTTGCCTGAAACAGTGATCCTGATAATCTTTTGAAGGCTAAGCCAGAGCTCGTTCC
ATCGTTGTTGACCATGGCACTGAATGATGCCATGACATACGACAAG
GTCTGGTCTCTGAATGGCTTTGTATCGTTAGCATTTGGGTCCCTCCGTTGGTTTAGAGAGCTGGTTTAATTCTT
CTGCAGACCACAAAAACTGGAGGCGCAAATGGATCTATCAGGCTAGGTAGCATTCTCTCTCTTTTTCCCCCTTCTCTGCTTCAGTTCTTCTGTTTGTTTTTTGTTTTGAGGGAAGGAAAT
GGTCAGCTGAAGATAATCTAACAAGTGACAAGTTTCTCGACCTTGACCATCCGTTGCTCCAGCATTTGATACTTAGTTTTTTGAAACAAAGCCCAGAAACAAGCAGACCTGAGAACAGTG
GGCTCTCTTCCGCGTTGGATTTGCTGACTGAAGCCAAAAAGGAGATCGATTCCTTTTCCAAGGGAGGTCCCATTTCGTTTGCAGATCTGATCCAGTTTGCAG
GTTCGACAATTCCCAGTG
CAGTTTACAACCATCGTGAAACTTGTTGATCTTTACTGGCAGGCTCTTCCGCACATGGGCTAGTTTTAAATTAAGGACTGTGTCTTTTTTCTTGAAACAGCACAATCAGCACTGAAGAGA
TCGTTTCTTGACGCTGCCATTGCCAAATGTGGTGGAAATGAAGAGAAGGGAAGAACACTGTACTCTGCATATGGTTCAAATGGGCAG
GTATGCACTATGCCATATCGCTCCTTATGCCAT
ATGCTGCTGCTGCATATGTTCAGTATATACGCTGCACAAGCTGCTCGTAATTTAAAGTGTTCAATTTATTTTTCTCTACGTTTTGACAATTTGTCACCACAGTGGGGTCTGTTCGATAGA
ACGTTCGGGAGAGCAGACGCACAGGAAGCAGATCCAGAGGGAAGAGTGCCTGACTGGAGCAAGGCTTCTGTGCAGGAGATGAAGGATAGGTTCGTCGCTGTTGGGTTGGGTCCTCGCCAG
GTCACTACTACCTCCTTATTAGACCGCTGAAATAAACTGTCTTAACTGATCACAATAGAGAGTAAAAAACTACAAAGCAGTCTCATGTTTAACAGAAGAAGGCTCCTTTTGCAGCTTGCT
GTTATGTCAGCGTTCCTTGGACCTGACCAGGCTGCTACGGAGGGACGACTGATAGCTGATCCGGATTGCCGTCCATGGGTGGAGAAGTACCAGCGGAGCCGCGAGACCGTCTCCCGGACT
GACTATGAG
GTAAGGACTCATTGATCTGTATGCGCTGGCAGTGCACAGCTATTCTGACTTGTGCTTGTTTGTTATGTATGACAGGTTGACCTGATAACTACACTCACAAAGCTGAGCTCC
CTTGGCCAGAAGATAAACTACGAAGCCTACACATACCCTAAGCAGAAGATTGACCTGGGAAAACTGAAACTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGAGCGAACTTCCTCTCCACCGCGGCGCTCGTCGCCCGCGGCGTCGCTGCCTGCTCTTCTATTTCAACTCCGACACGGAGGCACCCGCAAATCCGGGTGTGCTGCCGGGCTGAC
GTTGAGGCTATGGAGGCCTATGCCCATGAAGAGCGCCTTCGATTCCGTCGGAGAGATTTCATCGGCACCTGCGTCGGCACCGCTATTGGTTTG
GAAATGATCGACGGCTCTACGAGTTTC
TCTGGAGTGGCTACTGCAGCTGATCTCATTGAGCGTAGACAAAGGTCGGAGTTCCAAT
CAAAAATCAAAGACACCCTTTACGTAGCCATAAAGGCTAAGCCAGAGCTCGTTCCATCGTTG
TTGACCATGGCACTGAATGATGCCATGACATACGACAAG
ACCACAAAAACTGGAGGCGCAAATGGATCTATCAGGCTAGAAACAAGCAGACCTGAGAACAGTGGGCTCTCTTCCGCGTTG
GATTTGCTGACTGAAGCCAAAAAGGAGATCGATTCCTTTTCCAAGGGAGGTCCCATTTCGTTTGCAGATCTGATCCAGTTTGCAG
CACAATCAGCACTGAAGAGATCGTTTCTTGACGCT
GCCATTGCCAAATGTGGTGGAAATGAAGAGAAGGGAAGAACACTGTACTCTGCATATGGTTCAAATGGGCAG
TGGGGTCTGTTCGATAGAACGTTCGGGAGAGCAGACGCACAGGAAGCA
GATCCAGAGGGAAGAGTGCCTGACTGGAGCAAGGCTTCTGTGCAGGAGATGAAGGATAGGTTCGTCGCTGTTGGGTTGGGTCCTCGCCAG
CTTGCTGTTATGTCAGCGTTCCTTGGACCT
GACCAGGCTGCTACGGAGGGACGACTGATAGCTGATCCGGATTGCCGTCCATGGGTGGAGAAGTACCAGCGGAGCCGCGAGACCGTCTCCCGGACTGACTATGAG
GTTGACCTGATAACT
ACACTCACAAAGCTGAGCTCCCTTGGCCAGAAGATAAACTACGAAGCCTACACATACCCTAAGCAGAAGATTGACCTGGGAAAACTGAAACTGTAA

Retrieve as FASTA