Entry information : PcKat03
Entry ID 6717
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2009-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcKat03
Name PcKat03
Class Catalase    [Orthogroup: Kat002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcKat03
start..stop
S start..stop
CcinKat04 696 0 15..568 12..574
CcinKat03 696 0 15..568 12..572
SAcoKat02 670 0 6..557 8..566
PnoKat01 658 0 31..563 5..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 216382..216587 206 N° 2 216190..216325 136 N° 3 216038..216133 96 N° 4 215922..215985 64
N° 5 215795..215870 76 N° 6 215542..215743 202 N° 7 215220..215489 270 N° 8 214981..215159 179
N° 9 214861..214930 70 N° 10 214573..214780 208 N° 11 214297..214505 209  
complement(join(214297..214505,214573..214780,214861..214930,214981..215159,2152 20..215489,215542..215743,215795..215870,215922..215985,216038..216133,216190..2 16325,216382..216587))


exon

Literature and cross-references PcKat03
DNA ref. JGI genome:   scaffold_3 (216587..214297)
mRNA ref. JGI transcript:   127266
Protein sequence: PcKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   571
PWM (Da):   %s   64779.08  
PI (pH):   %s   8.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSANIIEQTLAKVPGVDPRVSQRTQFFSGLNEGPASTAARITGLTKEAHAKDDSPIYTGNFGQPIPDPAHSLNIGGIPYQGDTLLLEKQQAFVRMKIQERIVHPCGSSAFGYFVTKDVSNLTKAKFLQPGKQTPVYTRFSTVTYGREFPDSARNPRGFAVKFYTEDGNYDLVGLNFPVFFVRDPFMGPDNIRSQQRNPKSFLLDYNAWFDFLANVPESQHAGLMLFSDHATPVGWRFMSGYGCHTFKWVNADGKHVFVYHWISKQGVKQFTHDEALKVCGEDPDFAKRDLFEHIEKGGDARWTMMIQVMQPEQVAKVKFDPFDTTKIWPRSEFPMQEVGELILNRNPEDYFRDVEQAAFSPGSYVPGIEASPDALLQWRMFFYRDAQYHRLGSANIHQIPVNCPFMAKYHSTDNFNGTMRIDGNTGGKPYSTKEGTPGFDPTAVESPMQVANNVLSRQGHYFHEGKPSEYDQVRELYTRVLSQKERENLHQNTARLLKVIQKNYLIQQYAISPGYAKAIYDLLPKHEGYSFEDIKAKAPQAHMVWKNPQFMSSETKTFMGMPFGGKSA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGCGAACATCATCGAACAGACTCTCGCCAAGGTCCCAGGCGTGGATCCTCGCGTCTCGCAGCGCACCCAGTTCTTCTCTGGGCTCAACGAAGGCCCCGCCAGCACTGCTGCCCGT
ATCACCGGACTCACGAAGGAGGCCCACGCCAAAGATGATAGCCCCATCTACACCGGCAACTTCGGGCAGCCCATTCCTGACCCTGC
GTGAGTGCTTGCCTTACTTCGCTGGGTATATGCG
CTCATCATGGCTCTATTCGTAGTCATTCGCTCAATATCGGAGGCATTCCGTACCAGGGAGACACCTTGCTTTTAGAGAAGCAGCAGGCGTTTGTACGCATGAAAATCCAGGAGCGGATCG
TTCATCCCTGCGGTAGCTCCGCGTTCGGATACTTCCAG
GTTTGTCATCCAGCTTTAGAATCATTCGGTTAATTGCTGACAGCGTCGCGCTCAAGGTCACCAAAGACGTGTCCAACCTTAC
GAAGGCGAAATTCCTGCAGCCTGGAAAACAGACTCCTGTCTATACTCGCTTTTCTACTGTCACTTATGGT
GTACGTGTAGTAGGTTGTGGTCCTGAGCGTAACTGACGCGTCCCCGGGTT
AGCGCGAATTTCCGGACAGTGCTCGTAACCCCCGCGGGTTCGCCGTGAAGTTCTACACCGAAGATGGTAAGGTCCTCAGCTCTGTTTTTTCCGAACGATTGACCAAAGACGTCACAGGCA
ATTATGATCTCGTCGGTCTGAACTTCCCGGTCTTTTTCGTCCGCGATCCCTTCATGGGTCCAGACAACATTCG
GTACTGACAGCCAATCTATTGACTTGCGTTATCTCACGTACACGAAC
TTAGTTCGCAGCAACGCAATCCCAAGAGCTTCCTCCTCGACTACAACGCCTGGTTCGACTTCCTTGCAAACGTTCCCGAGTCGCAGCACGCAGGCTTGATGCTCTTCTCCGATCATGCTA
CGCCTGTCGGCTGGCGGTTCATGAGTGGCTACGGCTGTCACACATTCAAATGGGTCAACGCCGATGGAAAGCACGTCTTTGTCAAG
GTGCGTGCCATTCGGTGTACTGCATCGCAGACTA
CTCAAAAACTGTCGCTAGTACCATTGGATCTCGAAGCAAGGCGTGAAGCAGTTTACCCACGATGAGGCCCTCAAGGTCTGCGGAGAGGACCCTGACTTCGCAAAGCGGGACCTCTTCGAG
CATATCGAGAAGGGCGGCGATGCTCGATGGACAATGATGATCCAAGTTATGCAGCCTGAACAGGTTGCGAAAGTCAAATTCGATCCGTTCGATACAACCAAGATTTGGCCTCGCTCCGAG
TTCCCTATGCAAGAGGTCGGCGAGCTCATCCTGAATCGGAACCCCGAG
GTAGGTTGGGACAATACTGGGCTACTTGTTTCTCAGTTCCCTGACCTTGCGTCCATTCAGGACTATTTCAGG
GATGTAGAACAAGCAGCCTTCTCGCCTGGATCATACGTTCCTGGAATTGAAGCTTCTCCGGATGCACTCTTGCAGTGGCGCATGTTTTTCTATCGTGATGCCCAGTACCATCGCCTCGGC
AGCGCGAACATCCATCAAATACCCGTCAATTGTCCATTCATGGCGAA
GTGAGCATTAGCTCCCCTACACTGAACACTTCACTGATCATGACCGGCAGGTACCACTCGACGGATAACTTCA
ATGGAACGATGCGCATCGATGGAAACACCGGCGGAAAGCCATACTAT
GTCAGAACAATATCTGCGATTTTGTCCCTTCTTGACCACTTACACGATAACAGTTCCCCAATAGCTACCATAA
CAACCAGTCTACCAAGGAAGGGACTCCGGGCTTCGATCCCACCGCCGTAGAGTCGCCCATGCAGGTCGCGAACAACGTATTGTCTCGCCAGGGGCACTATTTCCACGAGGGAAAGCCTTC
CGAGTACGACCAAGTTCGCGAGTTATACACTCGCGTGCTCTCGCAGAAGGAGCGCGAGAATCTTCACCAGAACACTGCTCGTCTCCTCAAAGTGA
GTGCTTCACGGGGTCTTCCGTTAGT
TCCTTGATCAATCGACATGTCCGTAGCATGCCGACGGCATAGTCCAGAAGAACTATCTCATCCAGCAGTATGCGATCTCCCCCGGCTACGCCAAGGCTATCTACGATCTTCTTCCAAAGC
ACGAGGGCTACTCCTTCGAGGACATTAAAGCGAAGGCGCCGCAGGCTCATATGGTTTGGAAGAATCCCCAGTTCATGTCCTCCGAGACGAAAACGTTCATGGGCATGCCTTTTGGTGGGA
AGTCCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGCGAACATCATCGAACAGACTCTCGCCAAGGTCCCAGGCGTGGATCCTCGCGTCTCGCAGCGCACCCAGTTCTTCTCTGGGCTCAACGAAGGCCCCGCCAGCACTGCTGCCCGT
ATCACCGGACTCACGAAGGAGGCCCACGCCAAAGATGATAGCCCCATCTACACCGGCAACTTCGGGCAGCCCATTCCTGACCCTGC
TCATTCGCTCAATATCGGAGGCATTCCGTACCAG
GGAGACACCTTGCTTTTAGAGAAGCAGCAGGCGTTTGTACGCATGAAAATCCAGGAGCGGATCGTTCATCCCTGCGGTAGCTCCGCGTTCGGATACTTCCAG
GTCACCAAAGACGTGTCC
AACCTTACGAAGGCGAAATTCCTGCAGCCTGGAAAACAGACTCCTGTCTATACTCGCTTTTCTACTGTCACTTATGGT
CGCGAATTTCCGGACAGTGCTCGTAACCCCCGCGGGTTCGCC
GTGAAGTTCTACACCGAAGATG
GCAATTATGATCTCGTCGGTCTGAACTTCCCGGTCTTTTTCGTCCGCGATCCCTTCATGGGTCCAGACAACATTCGTTCGCAGCAACGCAATCCCAAG
AGCTTCCTCCTCGACTACAACGCCTGGTTCGACTTCCTTGCAAACGTTCCCGAGTCGCAGCACGCAGGCTTGATGCTCTTCTCCGATCATGCTACGCCTGTCGGCTGGCGGTTCATGAGT
GGCTACGGCTGTCACACATTCAAATGGGTCAACGCCGATGGAAAGCACGTCTTTGTCAAG
TACCATTGGATCTCGAAGCAAGGCGTGAAGCAGTTTACCCACGATGAGGCCCTCAAGGTC
TGCGGAGAGGACCCTGACTTCGCAAAGCGGGACCTCTTCGAGCATATCGAGAAGGGCGGCGATGCTCGATGGACAATGATGATCCAAGTTATGCAGCCTGAACAGGTTGCGAAAGTCAAA
TTCGATCCGTTCGATACAACCAAGATTTGGCCTCGCTCCGAGTTCCCTATGCAAGAGGTCGGCGAGCTCATCCTGAATCGGAACCCCGAG
GACTATTTCAGGGATGTAGAACAAGCAGCC
TTCTCGCCTGGATCATACGTTCCTGGAATTGAAGCTTCTCCGGATGCACTCTTGCAGTGGCGCATGTTTTTCTATCGTGATGCCCAGTACCATCGCCTCGGCAGCGCGAACATCCATCAA
ATACCCGTCAATTGTCCATTCATGGCGAA
GTACCACTCGACGGATAACTTCAATGGAACGATGCGCATCGATGGAAACACCGGCGGAAAGCCATACTATTCTACCAAGGAAGGGACTCCG
GGCTTCGATCCCACCGCCGTAGAGTCGCCCATGCAGGTCGCGAACAACGTATTGTCTCGCCAGGGGCACTATTTCCACGAGGGAAAGCCTTCCGAGTACGACCAAGTTCGCGAGTTATAC
ACTCGCGTGCTCTCGCAGAAGGAGCGCGAGAATCTTCACCAGAACACTGCTCGTCTCCTCAAAGTGA
TCCAGAAGAACTATCTCATCCAGCAGTATGCGATCTCCCCCGGCTACGCCAAG
GCTATCTACGATCTTCTTCCAAAGCACGAGGGCTACTCCTTCGAGGACATTAAAGCGAAGGCGCCGCAGGCTCATATGGTTTGGAAGAATCCCCAGTTCATGTCCTCCGAGACGAAAACG
TTCATGGGCATGCCTTTTGGTGGGAAGTCCGCCTGA

Retrieve as FASTA