Entry information : PcKat04
Entry ID 6718
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2009-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcKat04
Name PcKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcKat04
start..stop
S start..stop
PcarKat04 1367 0 1..740 1..742
PcKat05 1353 0 1..740 1..739
PcarKat05 1345 0 1..740 1..740
PplKat03 1214 0 19..740 19..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1580408..1580550 143 N° 2 1580260..1580357 98 N° 3 1580043..1580203 161 N° 4 1579911..1579989 79
N° 5 1579519..1579857 339 N° 6 1578975..1579464 490 N° 7 1578255..1578916 662 N° 8 1577955..1578205 251
complement(join(1577955..1578205,1578255..1578916,1578975..1579464,1579519..1579 857,1579911..1579989,1580043..1580203,1580260..1580357,1580408..1580550))


exon

Literature and cross-references PcKat04
DNA ref. JGI genome:   scaffold_3 (1580550..1577955)
mRNA ref. JGI transcript:   127288 [Incorrect splicing]
Protein sequence: PcKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   82987.96  
PI (pH):   %s   6.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVTAALKEKITAVAETKKIADLQKNFVKQESFLTTDHGVKVSDTDNWLKVTDGTTSGPLLLEDQIAREKIHRFDHERIERVVHARGTGAHGYFKVHSDAAKKYTFAPVLTDPSRNTSVFVRFSTVQGSRGSDTVRDVRGFAVKFYTEEGNWDIVGNDIPIFFIQDAMKFPDIVHAVKPEPHNEVPTGQSAHNNFWDFVGLQPESAHMIMWVMSDRGVPRSLRMMQGFGVNTYTLVNSQGERFFVKFHWIPELGVHSFVWDEALKICGQDPDFHRKDLKEAIDNGAFPKWHFGIQVIPEAREHDFDFDILDATKVWPEEAVPLEIIGEMVLNRTVDEFFPEVEQVAFCTSHIVPGIGFSDDPLLQGRNFSYFDTQISRLGVNWQELPINRPICPVMNYQRDGKMRHKIHQGTINYWPNRYEQFKPVPPEQGGFAEYPQKVAGMKARMRGAKFQEHFSQAQLFYNSLTDYEKEHLVNAISFELSHCDDPAVYEPYSKILNNIDFDLAKQVAIKVGGVVPEKPARENHGKSSPMLSQLYYAPKEPTIKSRRIAILVADGFSLAQVEGLRAAIKAGSATSWVIGPRRGWIYPEGEEVGSGKGGVWADHHFEGQRSTLYDAFIIPGGRKSAETLAENGRTIHWIREAFGHCKAIGAIGGVQFLREAVMLPGIEYNSNLGSDEVLSSFGVVTVGKIGASTLAADTLKIGKDEKGFVSKFAYEVSKHRCYDRELKGLTEKVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTGTGACTGCAGCGTTGAAGGAGAAAATCACTGCAGTGGCGGAGACGAAGAAGATCGCTGACCTGCAGAAGAATTTTGTCAAGCAGGAGAGCTTCCTTACCACTGACCATGGAGTC
AAAGTATCGGATACCGACAACTG
GTAAGTCAGTCCGACAACCAAAACTTTCGCTACTGACTGAGTCGTACCAGGCTCAAGGTCACGGACGGCACGACATCTGGTCCCTTACTTCTCGAAG
ATCAAATTGCGCGAGAGAAAATCCACCGCTTCGATCATGAACGCATCCCAG
GCACGTCCTTGTGTGCTGCCTGGTCACCGTTATATGCATATTGACTGTGGGCGCAGAACGGGTTGTTCA
TGCACGCGGAACCGGGGCACATGGCTACTTCAAGGTCCACAGCGACGCCGCGAAGAAGTACACGTTTGCCCCTGTTCTGACCGACCCGTCGCGAAACACGTCGGTTTTCGTTCGGTTTAG
CACTGTTCAGGGCTCCAGGGGCAGTGCT
GTGAGCGTTTATCGTGATATTCCAGCGAGTTCACCTAATAGCACGGCTCTCAGGATACCGTACGAGACGTCCGCGGATTCGCCGTCAAGTTC
TACACCGAGGAAGGTAATTGGGATATTGTCGGCAACGACA
GTCAGTGAATATAGACGTTCTACTATTCCTATACATCACTGACATGGTTTCAGTTCCTATCTTCTTTATCCAGGACGCGA
TGAAATTCCCTGATATCGTCCATGCCGTAAAACCCGAACCCCATAATGAAGTCCCGACAGGCCAGAGCGCACACAACAACTTTTGGGACTTCGTCGGGTTGCAGCCTGAGTCCGCTCACA
TGATCATGTGGGTCATGTCCGACCGCGGAGTACCCCGTTCGTTGCGTATGATGCAAGGCTTTGGCGTCAATACGTACACACTGGTCAACTCTCAAGGGGAACGCTTTTTCGTCAAGTTTC
ACTGGATCCCTGAGTTGGGTGTCCACAGCTTCGTTTGGGACGAAGCCTTGAAAATTTGCGGTCAGGATCCCG
GTACGCCAGTCTCATTGACGACCTATATGTCACCCAAACTAAGGTTGC
GCTTAGACTTCCATCGCAAGGATCTAAAGGAAGCCATTGACAACGGCGCCTTCCCGAAGTGGCACTTTGGAATCCAAGTCATTCCCGAGGCGCGTGAACACGACTTTGACTTCGACATCC
TTGACGCGACTAAGGTCTGGCCAGAGGAGGCGGTCCCTCTGGAGATTATCGGAGAGATGGTTCTCAACCGCACCGTCGACGAGTTCTTCCCCGAGGTGGAGCAGGTCGCCTTCTGCACCT
CCCACATCGTGCCCGGTATCGGCTTCAGCGACGATCCCCTGCTGCAGGGTCGCAACTTCTCTTACTTCGACACTCAGATCTCTCGTCTCGGTGTCAACTGGCAAGAACTTCCCATCAACA
GACCTATCTGCCCGGTAATGAATTACCAGCGCGACGGCAAAATGAGGCACAAGATCCACCAGGGTACCATCAACTATTGGCCTAACCGCTACGAGCAATTCAAGCCTGTACCTCCCGAAC
AAGGGGGTTTCGCCGA
GTAAGTTCGGGTACACACTCGGTCTGGATGCAATTAAGCTGATGCTTCGCTCTCCTAGGTATCCTCAGAAGGTTGCCGGTATGAAGGCTCGCATGAGGGGAGCT
AAATTCCAGGAGCACTTCAGTCAGGCGCAGCTCTTCTATAACTCGCTTACCGACTACGAGAAAGAACATCTCGTAAACGCCATCTCGTTCGAGCTCTCTCATTGCGATGATCCCGCCGTC
TACGAGCCATACAGCAAGATCCTAAACAACATCGACTTCGACCTTGCGAAGCAGGTTGCTATCAAGGTCGGCGGTGTGGTTCCCGAGAAGCCTGCGCGCGAAAACCACGGCAAGTCTTCG
CCGATGCTTTCGCAGCTCTACTATGCGCCCAAGGAGCCTACGATTAAGTCCCGCCGTATCGCAATCCTCGTCGCAGACGGCTTCTCTCTCGCTCAAGTTGAGGGCCTGCGTGCCGCTATC
AAAGCCGGCTCGGCGACGTCTTGGGTCATTGGGCCTCGGCGTGGGTGGATCTATCCCGAGGGCGAGGAGGTCGGGTCCGGCAAGGGTGGCGTCTGGGCGGACCACCACTTCGAAGGACAG
CGCAGCACGCTGTACGACGCGTTCATCATCCCTGGCGGCCGCAAGAGCGCGGAGACCCTGGCCGAAAACGGACGCACCATCCACTGGATCCGAGAGGCGTTCGGTCATTGCAAGGCTATC
GGTGCTATAGGCGAGG
GTGAGGAACACCCACGGCTTATTATGCATAATCACTGATCGATTACTAGGTGTCCAATTCCTCCGCGAGGCTGTGATGCTTCCGGGCATCGAGTACAACTCCAA
CTTGGGTAGCGATGAAGTGCTCTCTTCCTTCGGTGTCGTCACTGTTGGCAAGATTGGCGCATCTACGCTTGCGGCAGATACGCTCAAGATCGGCAAGGACGAGAAGGGCTTTGTCTCCAA
GTTTGCGTACGAGGTCAGCAAGCACCGGTGCTATGACCGCGAGCTCAAGGGCCTGACCGAGAAAGTTGCGTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTGTGACTGCAGCGTTGAAGGAGAAAATCACTGCAGTGGCGGAGACGAAGAAGATCGCTGACCTGCAGAAGAATTTTGTCAAGCAGGAGAGCTTCCTTACCACTGACCATGGAGTC
AAAGTATCGGATACCGACAACTG
GCTCAAGGTCACGGACGGCACGACATCTGGTCCCTTACTTCTCGAAGATCAAATTGCGCGAGAGAAAATCCACCGCTTCGATCATGAACGCATCCCA
G
AACGGGTTGTTCATGCACGCGGAACCGGGGCACATGGCTACTTCAAGGTCCACAGCGACGCCGCGAAGAAGTACACGTTTGCCCCTGTTCTGACCGACCCGTCGCGAAACACGTCGGTT
TTCGTTCGGTTTAGCACTGTTCAGGGCTCCAGGGGCAGTGCT
GATACCGTACGAGACGTCCGCGGATTCGCCGTCAAGTTCTACACCGAGGAAGGTAATTGGGATATTGTCGGCAACGAC
A
TTCCTATCTTCTTTATCCAGGACGCGATGAAATTCCCTGATATCGTCCATGCCGTAAAACCCGAACCCCATAATGAAGTCCCGACAGGCCAGAGCGCACACAACAACTTTTGGGACTTC
GTCGGGTTGCAGCCTGAGTCCGCTCACATGATCATGTGGGTCATGTCCGACCGCGGAGTACCCCGTTCGTTGCGTATGATGCAAGGCTTTGGCGTCAATACGTACACACTGGTCAACTCT
CAAGGGGAACGCTTTTTCGTCAAGTTTCACTGGATCCCTGAGTTGGGTGTCCACAGCTTCGTTTGGGACGAAGCCTTGAAAATTTGCGGTCAGGATCCCG
ACTTCCATCGCAAGGATCTA
AAGGAAGCCATTGACAACGGCGCCTTCCCGAAGTGGCACTTTGGAATCCAAGTCATTCCCGAGGCGCGTGAACACGACTTTGACTTCGACATCCTTGACGCGACTAAGGTCTGGCCAGAG
GAGGCGGTCCCTCTGGAGATTATCGGAGAGATGGTTCTCAACCGCACCGTCGACGAGTTCTTCCCCGAGGTGGAGCAGGTCGCCTTCTGCACCTCCCACATCGTGCCCGGTATCGGCTTC
AGCGACGATCCCCTGCTGCAGGGTCGCAACTTCTCTTACTTCGACACTCAGATCTCTCGTCTCGGTGTCAACTGGCAAGAACTTCCCATCAACAGACCTATCTGCCCGGTAATGAATTAC
CAGCGCGACGGCAAAATGAGGCACAAGATCCACCAGGGTACCATCAACTATTGGCCTAACCGCTACGAGCAATTCAAGCCTGTACCTCCCGAACAAGGGGGTTTCGCCGA
GTATCCTCAG
AAGGTTGCCGGTATGAAGGCTCGCATGAGGGGAGCTAAATTCCAGGAGCACTTCAGTCAGGCGCAGCTCTTCTATAACTCGCTTACCGACTACGAGAAAGAACATCTCGTAAACGCCATC
TCGTTCGAGCTCTCTCATTGCGATGATCCCGCCGTCTACGAGCCATACAGCAAGATCCTAAACAACATCGACTTCGACCTTGCGAAGCAGGTTGCTATCAAGGTCGGCGGTGTGGTTCCC
GAGAAGCCTGCGCGCGAAAACCACGGCAAGTCTTCGCCGATGCTTTCGCAGCTCTACTATGCGCCCAAGGAGCCTACGATTAAGTCCCGCCGTATCGCAATCCTCGTCGCAGACGGCTTC
TCTCTCGCTCAAGTTGAGGGCCTGCGTGCCGCTATCAAAGCCGGCTCGGCGACGTCTTGGGTCATTGGGCCTCGGCGTGGGTGGATCTATCCCGAGGGCGAGGAGGTCGGGTCCGGCAAG
GGTGGCGTCTGGGCGGACCACCACTTCGAAGGACAGCGCAGCACGCTGTACGACGCGTTCATCATCCCTGGCGGCCGCAAGAGCGCGGAGACCCTGGCCGAAAACGGACGCACCATCCAC
TGGATCCGAGAGGCGTTCGGTCATTGCAAGGCTATCGGTGCTATAGGCGAGG
GTGTCCAATTCCTCCGCGAGGCTGTGATGCTTCCGGGCATCGAGTACAACTCCAACTTGGGTAGCGAT
GAAGTGCTCTCTTCCTTCGGTGTCGTCACTGTTGGCAAGATTGGCGCATCTACGCTTGCGGCAGATACGCTCAAGATCGGCAAGGACGAGAAGGGCTTTGTCTCCAAGTTTGCGTACGAG
GTCAGCAAGCACCGGTGCTATGACCGCGAGCTCAAGGGCCTGACCGAGAAAGTTGCGTATTGA

Retrieve as FASTA