Entry information : PcKat05
Entry ID 6722
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2009-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcKat05
Name PcKat05
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcKat05
start..stop
S start..stop
PcarKat05 1414 0 1..739 1..740
PcKat04 1353 0 1..739 1..740
PcarKat04 1342 0 1..739 1..742
PplKat03 1226 0 19..739 19..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 309266..309412 147 N° 2 309116..309206 91 N° 3 308903..309063 161 N° 4 308766..308844 79
N° 5 308376..308714 339 N° 6 307833..308322 490 N° 7 307117..307778 662 N° 8 306813..307063 251
complement(join(306813..307063,307117..307778,307833..308322,308376..308714,3087 66..308844,308903..309063,309116..309206,309266..309412))


exon

Literature and cross-references PcKat05
DNA ref. JGI genome:   scaffold_11 (309412..306813)
mRNA ref. JGI transcript:   134956
Protein sequence: PcKat05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   739
PWM (Da):   %s   82595.57  
PI (pH):   %s   6.48
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLTAAIKEKVTAVAQTKKIADLQKDTLKQENYLNTDHGVMVSNTDDWCAVDGTHAGPSLLEDQIAREKIHRFDHERIPERVVHARGTGAHGYFKVYSDAAKKYTFAPVLTDPSRTTPTFVRFSTVQGSKGSDTVRDVRGFATKFYTDEGNWDLVGNNIPVFFIQDAIKFPDVIHAVKPEPHNEVPQGQSAHNNFWDFVGLQPESAHMVMWVMSDRGIPRSYRMMQGFGVNTYTLVNAQGERFFVKFHWIPELGVHSLMWDEALKIAGQDPDFHRKDLEEAIANGAYPKWQFGIQVIPEAKEHDFDFDILDATKVWPEELVPIEIIGEMVLNRNVDEFFPETEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGINWEELPINRPVCPVMNFNRDGKMRHKIYQGTINYWPNRAGQFKPVAPEEGGYVEYAQKIAGMKARMRGAKFKEHFNQAQLFFNSLTDFEKKHVIDAISFELSHCDDPVVYQTYTKVLNQIDFNLAKQVAINVGGVVPDAPARENHGKSTPTLSQLYYAPKEPTIKSRRIAILVADGFDLAQVEGLRAAIKAGMATSWVIGPRRGWVYPDGSEIGSGKGGVWADHHFEGQRSTMFDAFIVPGGRKSAEALAENGRAIHWIREAFGHCKTIGAIGGVLFLREAVMLPGVEYNTNLDSDDVVTSYGVVTVGKISTSTLAADTLKVAQGEKGFISNFAYEVSKHRCYERELKGLITKVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTGACCGCAGCCATCAAGGAAAAGGTTACTGCCGTCGCGCAGACCAAGAAGATTGCCGACCTGCAGAAGGACACATTGAAGCAGGAGAACTACCTCAACACCGACCATGGCGTC
ATGGTCTCTAATACGGACGACTGGTGC
GTATTTAGGACGCCACACTACGCGAGGGCGTGTGCTGACTTTGTATCCGTAGGCTGAAGGCCGTGGACGGCACCCACGCGGGACCCTCACTTC
TTGAAGACCAAATTGCTCGCGAGAAGATCCACCGCTTTGACCATGAACGTATTCCAG
GTAGGTGGTGTCCACCTTGTATCTGCGACGCGGCTGCTGACAGGCCTTGTAGAGCGCGTCGTT
CACGCACGAGGTACCGGTGCGCACGGCTACTTCAAGGTCTACAGCGACGCCGCAAAGAAGTACACCTTCGCTCCCGTCCTCACCGATCCATCGCGCACAACGCCCACTTTCGTACGCTTC
AGTACGGTGCAGGGCTCCAAAGGTAGTGCG
GTGAGTGTCTTCGCTAGGCTGTCTTCACCCACCACAGGTGCTGAACGACATTGTCTAGGACACCGTTCGAGACGTGCGGGGATTCGCTAC
AAAGTTTTACACGGATGAAGGTAACTGGGACCTCGTCGGAAATAACA
GTGAGTCTTGCGTAGCGTATCCAGGAATATCCTCGCTGACTGTCGAGGCAGTCCCGGTCTTCTTCATCCAGGA
TGCCATCAAGTTTCCCGACGTCATTCACGCCGTCAAGCCCGAGCCTCACAACGAAGTACCCCAAGGCCAGAGTGCACACAACAACTTCTGGGACTTCGTTGGCCTCCAGCCCGAGTCGGC
ACATATGGTTATGTGGGTCATGTCCGACCGTGGCATCCCCCGCTCGTACCGCATGATGCAGGGCTTTGGTGTCAACACCTACACTCTCGTCAATGCGCAGGGCGAACGCTTCTTCGTGAA
ATTCCACTGGATTCCGGAGCTCGGTGTCCACAGCCTGATGTGGGATGAGGCTCTGAAGATCGCTGGCCAGGATCCCG
GTAAGCATCCGCTTTGACAAGGCACCCGATCGATCATGTTGAC
CTTCTCGCAGACTTCCATCGCAAGGATCTCGAGGAGGCGATCGCCAATGGTGCCTACCCCAAGTGGCAATTTGGCATTCAAGTCATTCCTGAGGCCAAAGAACACGACTTCGACTTCGAC
ATCCTCGATGCTACCAAGGTCTGGCCCGAGGAGCTCGTCCCTATAGAAATCATCGGTGAGATGGTCTTGAACCGCAATGTCGACGAGTTCTTCCCGGAGACCGAGCAAGTCGCTTTCTGC
ACCTCGCATGTCGTACCCGGTATCGGCTTCAGTGACGACCCTCTCCTCCAAGGCCGTAACTTCTCGTACTTTGACACTCAGATCAGTCGCCTCGGAATCAACTGGGAGGAGCTTCCGATC
AACAGACCTGTCTGCCCTGTCATGAACTTCAACAGGGACGGCAAGATGAGGCACAAGATCTACCAGGGCACGATCAACTACTGGCCGAACCGTGCTGGTCAGTTCAAGCCTGTGGCTCCG
GAAGAGGGAGGATACGTTGA
GTAAGTCGCGTGCCTTGACTCCAGTGGGATTACAGCAGCTCACATATCCTGTAGATATGCACAGAAGATCGCCGGAATGAAGGCTCGTATGCGTGGTGCC
AAGTTCAAGGAGCACTTCAACCAGGCGCAGCTCTTCTTCAACTCGCTCACGGACTTCGAGAAGAAGCACGTCATCGACGCCATTTCTTTCGAGCTTTCTCACTGCGACGACCCGGTCGTG
TACCAGACATACACGAAGGTCCTCAACCAGATCGACTTCAACCTCGCGAAGCAAGTCGCGATCAACGTCGGCGGTGTCGTTCCCGACGCGCCCGCGCGCGAGAACCACGGCAAGTCGACG
CCAACGCTGTCGCAGCTGTACTATGCCCCGAAGGAGCCGACCATCAAGTCTCGCCGCATCGCGATCCTCGTCGCGGACGGCTTCGATCTCGCGCAGGTCGAGGGCCTCCGTGCGGCGATC
AAGGCAGGCATGGCCACCTCCTGGGTCATTGGCCCGCGCCGCGGCTGGGTGTACCCCGACGGCTCTGAGATCGGCTCTGGCAAGGGTGGTGTGTGGGCCGACCACCACTTCGAGGGCCAG
CGCAGCACGATGTTCGATGCGTTCATCGTTCCCGGTGGACGCAAGAGCGCCGAGGCTCTCGCGGAGAACGGGCGTGCCATCCACTGGATCCGTGAGGCATTCGGGCACTGCAAGACTATT
GGTGCCATCGGCGAGG
GTTAGTGACGCTCAACTTTGAAGGGTGATCCCAGTTTCTGACATACCGTCCAGGTGTTCTCTTCCTGCGCGAGGCTGTCATGCTCCCTGGCGTCGAGTACAACA
CCAACCTGGACAGCGACGACGTCGTTACCTCGTACGGTGTCGTCACCGTCGGCAAGATCAGCACTTCGACGCTTGCGGCCGACACGCTCAAGGTCGCACAGGGCGAGAAGGGCTTCATCT
CCAACTTTGCATACGAAGTCAGCAAGCACCGTTGCTACGAGCGCGAGCTCAAAGGCCTGATCACGAAGGTCGCCTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTGACCGCAGCCATCAAGGAAAAGGTTACTGCCGTCGCGCAGACCAAGAAGATTGCCGACCTGCAGAAGGACACATTGAAGCAGGAGAACTACCTCAACACCGACCATGGCGTC
ATGGTCTCTAATACGGACGACTGGTGC
GCCGTGGACGGCACCCACGCGGGACCCTCACTTCTTGAAGACCAAATTGCTCGCGAGAAGATCCACCGCTTTGACCATGAACGTATTCCAGAG
CGCGTCGTTCACGCACGAGGTACCGGTGCGCACGGCTACTTCAAGGTCTACAGCGACGCCGCAAAGAAGTACACCTTCGCTCCCGTCCTCACCGATCCATCGCGCACAACGCCCACTTTC
GTACGCTTCAGTACGGTGCAGGGCTCCAAAGGTAGTGCG
GACACCGTTCGAGACGTGCGGGGATTCGCTACAAAGTTTTACACGGATGAAGGTAACTGGGACCTCGTCGGAAATAACATC
CCGGTCTTCTTCATCCAGGATGCCATCAAGTTTCCCGACGTCATTCACGCCGTCAAGCCCGAGCCTCACAACGAAGTACCCCAAGGCCAGAGTGCACACAACAACTTCTGGGACTTCGTT
GGCCTCCAGCCCGAGTCGGCACATATGGTTATGTGGGTCATGTCCGACCGTGGCATCCCCCGCTCGTACCGCATGATGCAGGGCTTTGGTGTCAACACCTACACTCTCGTCAATGCGCAG
GGCGAACGCTTCTTCGTGAAATTCCACTGGATTCCGGAGCTCGGTGTCCACAGCCTGATGTGGGATGAGGCTCTGAAGATCGCTGGCCAGGATCCCG
ACTTCCATCGCAAGGATCTCGAG
GAGGCGATCGCCAATGGTGCCTACCCCAAGTGGCAATTTGGCATTCAAGTCATTCCTGAGGCCAAAGAACACGACTTCGACTTCGACATCCTCGATGCTACCAAGGTCTGGCCCGAGGAG
CTCGTCCCTATAGAAATCATCGGTGAGATGGTCTTGAACCGCAATGTCGACGAGTTCTTCCCGGAGACCGAGCAAGTCGCTTTCTGCACCTCGCATGTCGTACCCGGTATCGGCTTCAGT
GACGACCCTCTCCTCCAAGGCCGTAACTTCTCGTACTTTGACACTCAGATCAGTCGCCTCGGAATCAACTGGGAGGAGCTTCCGATCAACAGACCTGTCTGCCCTGTCATGAACTTCAAC
AGGGACGGCAAGATGAGGCACAAGATCTACCAGGGCACGATCAACTACTGGCCGAACCGTGCTGGTCAGTTCAAGCCTGTGGCTCCGGAAGAGGGAGGATACGTTGA
ATATGCACAGAAG
ATCGCCGGAATGAAGGCTCGTATGCGTGGTGCCAAGTTCAAGGAGCACTTCAACCAGGCGCAGCTCTTCTTCAACTCGCTCACGGACTTCGAGAAGAAGCACGTCATCGACGCCATTTCT
TTCGAGCTTTCTCACTGCGACGACCCGGTCGTGTACCAGACATACACGAAGGTCCTCAACCAGATCGACTTCAACCTCGCGAAGCAAGTCGCGATCAACGTCGGCGGTGTCGTTCCCGAC
GCGCCCGCGCGCGAGAACCACGGCAAGTCGACGCCAACGCTGTCGCAGCTGTACTATGCCCCGAAGGAGCCGACCATCAAGTCTCGCCGCATCGCGATCCTCGTCGCGGACGGCTTCGAT
CTCGCGCAGGTCGAGGGCCTCCGTGCGGCGATCAAGGCAGGCATGGCCACCTCCTGGGTCATTGGCCCGCGCCGCGGCTGGGTGTACCCCGACGGCTCTGAGATCGGCTCTGGCAAGGGT
GGTGTGTGGGCCGACCACCACTTCGAGGGCCAGCGCAGCACGATGTTCGATGCGTTCATCGTTCCCGGTGGACGCAAGAGCGCCGAGGCTCTCGCGGAGAACGGGCGTGCCATCCACTGG
ATCCGTGAGGCATTCGGGCACTGCAAGACTATTGGTGCCATCGGCGAGG
GTGTTCTCTTCCTGCGCGAGGCTGTCATGCTCCCTGGCGTCGAGTACAACACCAACCTGGACAGCGACGAC
GTCGTTACCTCGTACGGTGTCGTCACCGTCGGCAAGATCAGCACTTCGACGCTTGCGGCCGACACGCTCAAGGTCGCACAGGGCGAGAAGGGCTTCATCTCCAACTTTGCATACGAAGTC
AGCAAGCACCGTTGCTACGAGCGCGAGCTCAAAGGCCTGATCACGAAGGTCGCCTACTAA

Retrieve as FASTA