Entry information : PanHalPrx01
Entry ID 6784
Creation 2009-05-13 (Christophe Dunand)
Last sequence changes 2013-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Christophe Dunand)
Peroxidase information: PanHalPrx01
Name PanHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Lasiosphaeriaceae Podospora
Organism Podospora anserina    [TaxId: 5145 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PanHalPrx01
start..stop
S start..stop
PnoHalPrx08 324 1e-108 14..383 46..414
PnoHalPrx11 285 6e-94 44..384 37..378
AteHalPrx03 133 2e-35 51..382 74..421
PnoHalPrx13 125 1e-32 58..382 66..406
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 247193..247433 241 N° 2 247489..247906 418 N° 3 247960..248070 111 N° 4 248128..248518 391
join(247193..247433,247489..247906,247960..248070,248128..248518)


exon

Literature and cross-references PanHalPrx01
Protein ref. UniProtKB:   B2AFP6
DNA ref. GenBank:   CU633461.1 (247193..248518)
mRNA ref. GenBank:   XM_001904450
Protein sequence: PanHalPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   386
PWM (Da):   %s   42170.81  
PI (pH):   %s   5.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPKSGGAQPGGPLTCPFNPNHQPAARWDPDFPYNHAKLGLPGKGKGGYKVPADGDTAHAFMPPTDKDIRGPCPGLNALANHNFIARDGITDYNELLDALQNVYNVGYDLANFLAFYAIYVAGLGDPVTKKLSIGCDATTRTSWSPIITGSEPGLNGHSKMEIDASLTRNDFFAAGGDNFSFNTTLFKMFEQSTSGLFDVDRISKYRHERWHQCQAENPQFYFPILGLFQYGAASFLYELWPNGNEGYVPNLHNTATFFGAHRLPDGNYLRVPERIPSNWVNRENPYFLLDIASEIFKMYTKNPVGFGGNAGGEFIGINHPPYINDGALNANTTAQDVTCLLYQILSRPVPSTLNGIITPLVEATEALLISLFGVEYNNLGCPLALT

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAAGTCCGGTGGTGCCCAGCCCGGCGGTCCTCTGACTTGCCCCTTCAACCCTAATCACCAGCCAGCTGCCAGATGGGACCCAGATTTCCCTTACAACCACGCAAAGCTCGGTCTC
CCAGGCAAAGGCAAAGGCGGGTATAAAGTCCCTGCTGATGGCGATACTGCCCATGCCTTCATGCCGCCGACGGACAAAGACATCAGAGGTCCTTGCCCTGGACTGAATGCTTTGGCTAAT
C
GTGCGTGCGCTTAGCAAGACAATTGAAGGGACACCACTAACCCTCACCTACGTAGATAACTTTATTGCCCGTGATGGTATTACCGATTACAACGAGTTGCTCGACGCTCTTCAGAACGT
CTACAACGTTGGCTATGACCTGGCGAACTTCCTTGCCTTCTACGCCATCTACGTCGCCGGCCTTGGAGATCCCGTCACCAAGAAGCTGTCCATCGGCTGTGATGCCACCACACGTACCTC
GTGGAGCCCAATCATCACTGGCAGCGAGCCCGGCCTGAACGGCCACAGCAAGATGGAGATCGACGCGTCACTCACCCGGAATGATTTCTTCGCTGCCGGTGGTGACAACTTCAGCTTCAA
CACTACCCTGTTCAAGATGTTTGAACAGTCCACCAGTGGACTCTTTGACGTTGACCGAATCTCCAAGTACCGTCATGAACGGTGGCATCAGTGCCAGGCTGAGAACCCACAATT
GTGAGT
CTTGACATGCAAAGCAGCGGAAGCCAACCCCTAACCATTGACTCCAGCTACTTCCCCATCCTCGGCCTCTTCCAATACGGCGCCGCCTCCTTCCTCTACGAACTCTGGCCGAATGGAAAT
GAGGGCTATGTCCCCAACTTGCACAACACCGCCACTTT
GTAAGTTTTGATGCTTGTCCATCCATCACATCACCCTTGATGCTAATCTTGTCAAAGCTTTGGAGCCCACCGCCTCCCAGAC
GGCAACTACCTCCGCGTTCCTGAGCGTATTCCCTCCAACTGGGTCAACCGCGAGAATCCTTACTTCCTGCTAGACATCGCCTCGGAGATCTTCAAGATGTACACCAAGAACCCAGTTGGC
TTTGGTGGCAATGCTGGAGGGGAGTTTATTGGCATCAACCACCCTCCTTACATCAATGATGGTGCGCTCAATGCCAATACCACTGCCCAGGATGTCACTTGTTTGTTGTATCAGATCCTC
TCGAGGCCGGTTCCGAGCACACTGAATGGTATTATTACTCCTTTGGTTGAGGCGACGGAGGCGCTTTTGATCAGCTTGTTTGGGGTTGAGTATAATAATTTGGGGTGCCCGCTGGCTTTG
ACGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAAGTCCGGTGGTGCCCAGCCCGGCGGTCCTCTGACTTGCCCCTTCAACCCTAATCACCAGCCAGCTGCCAGATGGGACCCAGATTTCCCTTACAACCACGCAAAGCTCGGTCTC
CCAGGCAAAGGCAAAGGCGGGTATAAAGTCCCTGCTGATGGCGATACTGCCCATGCCTTCATGCCGCCGACGGACAAAGACATCAGAGGTCCTTGCCCTGGACTGAATGCTTTGGCTAAT
C
ATAACTTTATTGCCCGTGATGGTATTACCGATTACAACGAGTTGCTCGACGCTCTTCAGAACGTCTACAACGTTGGCTATGACCTGGCGAACTTCCTTGCCTTCTACGCCATCTACGTC
GCCGGCCTTGGAGATCCCGTCACCAAGAAGCTGTCCATCGGCTGTGATGCCACCACACGTACCTCGTGGAGCCCAATCATCACTGGCAGCGAGCCCGGCCTGAACGGCCACAGCAAGATG
GAGATCGACGCGTCACTCACCCGGAATGATTTCTTCGCTGCCGGTGGTGACAACTTCAGCTTCAACACTACCCTGTTCAAGATGTTTGAACAGTCCACCAGTGGACTCTTTGACGTTGAC
CGAATCTCCAAGTACCGTCATGAACGGTGGCATCAGTGCCAGGCTGAGAACCCACAATT
CTACTTCCCCATCCTCGGCCTCTTCCAATACGGCGCCGCCTCCTTCCTCTACGAACTCTGG
CCGAATGGAAATGAGGGCTATGTCCCCAACTTGCACAACACCGCCACTTT
CTTTGGAGCCCACCGCCTCCCAGACGGCAACTACCTCCGCGTTCCTGAGCGTATTCCCTCCAACTGGGTC
AACCGCGAGAATCCTTACTTCCTGCTAGACATCGCCTCGGAGATCTTCAAGATGTACACCAAGAACCCAGTTGGCTTTGGTGGCAATGCTGGAGGGGAGTTTATTGGCATCAACCACCCT
CCTTACATCAATGATGGTGCGCTCAATGCCAATACCACTGCCCAGGATGTCACTTGTTTGTTGTATCAGATCCTCTCGAGGCCGGTTCCGAGCACACTGAATGGTATTATTACTCCTTTG
GTTGAGGCGACGGAGGCGCTTTTGATCAGCTTGTTTGGGGTTGAGTATAATAATTTGGGGTGCCCGCTGGCTTTGACGTGA

Retrieve as FASTA