Entry information : PnoCIIAA01
Entry ID 6789
Creation 2009-05-13 (Christophe Dunand)
Last sequence changes 2012-11-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCIIAA01
Name PnoCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCIIAA01
start..stop
S start..stop
Ssrc1lsm3aCIIAA02 754 0 48..446 1..400
COsaCIIAA05 690 0 48..447 1..399
CheCIIAA05_C5 686 0 48..447 1..399
CheCIIAA05_C4 686 0 48..447 1..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 144311..144381 71 N° 2 143663..144183 521 N° 3 143065..143606 542 N° 4 142805..143014 210
complement(join(142805..143014,143065..143606,143663..144183,144311..144381))


exon

Literature and cross-references PnoCIIAA01
Protein ref. UniProtKB:   Q0U3X5
DNA ref. JGI genome:   scaffold_27 (144381..142805)
mRNA ref. GenBank:   XM_001803696
Protein sequence: PnoCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   447
PWM (Da):   %s   49304.34 Transmb domain:   %s   i13-35o
PI (pH):   %s   6.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVHHDKAFEWQTVLCEGFVFIYTHAVCLITQVIFDNFFLHSLPFAKMRTLSYLNYALLACAPLVDAHPGMGEKMMFEMKRAANKEKRASSKELIGDLATLADSKLTSIGKDIKAIITDQKSGESQERDTSIPAGAIGSAACKADLCCHWKWLSYEMTAKFNGTSGRCNKFARQAVRLGFHDAGVWSKTAGYGGADSLLLSNEMSRTDNNGLSQIAEQTKKWYTKYNQYGLSMADIIQFGANVATVVCPLGPRIRTFVGRKDNSKAGPTSLLPTETDSADALLKLFSAKTIDAHDLVALVGAHTTSQQHFVDTTRSGDPQDSSPGVWDMAFYPQTSNTSPPRVLKFQSDVNLSKDSRTIGEWQEFSDRNSGQNHWNDYAKAYTRLSMLGVNNINDLKECTKVLPPARTSFVNEDQVVLDMWLQGQFDQLNDMVDDAIQLTGVVSG*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Strain="SN15". No EST. Sequence without C-Term (last 3 exons are missing) and longer N-Term.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGTGCATCACGACAAGGCATTTGAATGGCAAACTGTGCTTTGCGAGGGCTTCGTGTTCATCTATACGTGGGTTCACGGCTTCAACACGGCGCAATTGCCCAGGTATCAATTTATT
CGACATCGCAGGTGCATTCTGGACTTGATGAAGTAGTTAACCCAGCTGCACTCCTTGGACTTTCGAGACTATAAGAAGCCATGCTGTCTGCCTCATTACGCAAGTCATATTCGACAACTT
CTTTCTACATTCGCTTCCTTTTGCTAAGATGAGGACTCTTTCGTACTTGAACTATGCACTTCTTGCATGTGCGCCTCTCGTCGACGCTCACCCAGGCATGGGCGAGAAGATGATGTTTGA
GATGAAGCGCGCCGCAAACAAGGAAAAGCGAGCATCCTCAAAAGAGCTTATTGGCGATCTGGCAACTCTGGCCGACTCCAAGCTTACCTCCATTGGCAAGGACATCAAGGCGATCATCAC
CGACCAGAAGAGCGGAGAGTCACAAGAGCGTGACACATCCATCCCAGCTGGAGCTATCGGCAGCGCAGCATGCAAAGCCGACCTTTGCTGTCACTGGAAATGGCTCTCCTACGAGATGAC
AGCCAAGTTCAACGGCACCTCCGGCCGTTGTAACAAATTCGCCCGTCAAGCCGTCCGTCTCGGCTTCCACGACGCAGGCGTATGGTCCAAGACAGCCGGCTACGGCGGCGCAGATGGCA
G
TAAGTCCATCTCCACACTCTCCCCCGATCCATCCCACAACCTAACCCCCTACCAGGCCTCCTCCTCAGCAACGAAATGTCGCGCACCGACAACAACGGGCTCTCCCAGATCGCCGAGCAA
ACCAAAAAATGGTACACCAAGTACAACCAATACGGCCTCTCCATGGCCGACATCATCCAATTCGGCGCCAACGTCGCCACCGTCGTGTGCCCGCTGGGCCCACGCATCCGCACCTTCGTC
GGACGCAAGGACAACAGCAAAGCCGGGCCCACCAGCCTCCTCCCCACCGAAACCGACTCCGCGGACGCCCTGCTCAAGCTGTTTTCCGCAAAGACCATCGACGCGCATGATCTCGTTGCG
CTGGTGGGCGCGCACACGACGTCGCAGCAGCACTTTGTCGACACGACGCGCAGCGGGGATCCGCAGGATAGCTCGCCGGGCGTGTGGGACATGGCGTTTTACCCACAGACGAGTAACACG
AGTCCGCCGCGTGTGTTGAAGTTTCAGAGCGATGTGAATCTGAGCAAGGATAGTCGGACGATTGGCGAGTGGCAGGAGTTCAGTGATCGGAACAGTGGGCAGAATCATTGGAATGAG
GTG
AGTTTGAATGTACGAGGGGGAAGGGGATGGGCTAATTTTTCATACAGGACTATGCGAAGGCGTATACGAGGCTGTCTATGCTGGGGGTTAATAATATCAATGATTTGAAGGAGTGCACGA
AGGTTTTGCCGCCGGCGCGCACGTCGTTTGTTAATGAGGATCAGGTTGTTTTGGATATGTGGTTGCAGGGACAGTTTGATCAGCTGAACGATATGGTTGATGATGCTATACAGCTTACCG
GTGTGGTCAGCGGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGTGCATCACGACAAGGCATTTGAATGGCAAACTGTGCTTTGCGAGGGCTTCGTGTTCATCTATACCCATGCTGTCTGCCTCATTACGCAAGTCATATTCGACAACTTCTTTCTA
CATTCGCTTCCTTTTGCTAAGATGAGGACTCTTTCGTACTTGAACTATGCACTTCTTGCATGTGCGCCTCTCGTCGACGCTCACCCAGGCATGGGCGAGAAGATGATGTTTGAGATGAAG
CGCGCCGCAAACAAGGAAAAGCGAGCATCCTCAAAAGAGCTTATTGGCGATCTGGCAACTCTGGCCGACTCCAAGCTTACCTCCATTGGCAAGGACATCAAGGCGATCATCACCGACCAG
AAGAGCGGAGAGTCACAAGAGCGTGACACATCCATCCCAGCTGGAGCTATCGGCAGCGCAGCATGCAAAGCCGACCTTTGCTGTCACTGGAAATGGCTCTCCTACGAGATGACAGCCAAG
TTCAACGGCACCTCCGGCCGTTGTAACAAATTCGCCCGTCAAGCCGTCCGTCTCGGCTTCCACGACGCAGGCGTATGGTCCAAGACAGCCGGCTACGGCGGCGCAGATGGCA
GCCTCCTC
CTCAGCAACGAAATGTCGCGCACCGACAACAACGGGCTCTCCCAGATCGCCGAGCAAACCAAAAAATGGTACACCAAGTACAACCAATACGGCCTCTCCATGGCCGACATCATCCAATTC
GGCGCCAACGTCGCCACCGTCGTGTGCCCGCTGGGCCCACGCATCCGCACCTTCGTCGGACGCAAGGACAACAGCAAAGCCGGGCCCACCAGCCTCCTCCCCACCGAAACCGACTCCGCG
GACGCCCTGCTCAAGCTGTTTTCCGCAAAGACCATCGACGCGCATGATCTCGTTGCGCTGGTGGGCGCGCACACGACGTCGCAGCAGCACTTTGTCGACACGACGCGCAGCGGGGATCCG
CAGGATAGCTCGCCGGGCGTGTGGGACATGGCGTTTTACCCACAGACGAGTAACACGAGTCCGCCGCGTGTGTTGAAGTTTCAGAGCGATGTGAATCTGAGCAAGGATAGTCGGACGATT
GGCGAGTGGCAGGAGTTCAGTGATCGGAACAGTGGGCAGAATCATTGGAATGAG
GACTATGCGAAGGCGTATACGAGGCTGTCTATGCTGGGGGTTAATAATATCAATGATTTGAAGGAG
TGCACGAAGGTTTTGCCGCCGGCGCGCACGTCGTTTGTTAATGAGGATCAGGTTGTTTTGGATATGTGGTTGCAGGGACAGTTTGATCAGCTGAACGATATGGTTGATGATGCTATACAG
CTTACCGGTGTGGTCAGCGGATGA

Retrieve as FASTA