Entry information : PnoCIIAA02
Entry ID 6790
Creation 2009-05-13 (Christophe Dunand)
Last sequence changes 2011-10-18 (Catherine Mathe)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCIIAA02
Name PnoCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCIIAA02
start..stop
S start..stop
CberCIIAA02 492 6e-175 42..370 18..342
ZbreCIIAA 341 2e-115 42..360 66..385
ApulCIIAA01 333 2e-112 43..357 53..366
LfluCIIAA03 330 3e-111 42..357 50..367
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 792859..792927 69 N° 2 792800..792824 25 N° 3 792097..792479 383 N° 4 791295..792033 739
N° 5 791097..791137 41  
complement(join(791097..791137,791295..792033,792097..792479,792800..792824,7928 59..792927))


exon

Literature and cross-references PnoCIIAA02
Protein ref. UniProtKB:   Q0U9C5 [Incorrect prediction]
DNA ref. JGI genome:   scaffold_19 (792927..791097)
Protein sequence: PnoCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   418 (400)
PWM (Da):   %s   44789.03 (42859.9)  
PI (pH):   %s   4.78 (4.70) Peptide Signal:   %s   cut: 19 range:19-418
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPPPLLAVLLLTSEVKAHLHNESRGDKDGPEVGDDGPDGGLIGDLNDGILSPEGQNIADILLGNGKTTEENFEIGTRPGFDDHTDCDGKDPCCRWYYISKDLTAVFHNADGTCNSLARQSIRMGFHDAGTWSAKLAASGKNNGGADGSLVLFGELSRENFGMEGAVDLASRLYHTYNVTMADLIQYMANHAVVSCPLGPRVRTYVGRKDATEAAPEGLLPSVHAPADELIALFADKTISAHELTALMGAHSTSTQSNVDASKAGYPQDTTPGVWDVNYYNETLDATENGCIFKLESDVKLSKHPAMAVEWQKFVGGQAHWNADYAKAYLRLSLLGVNNINELKECTLTLPAQQATAPKDSDLNVSGKCTASSSSSLISSSTITIPNTTNNPLSITEILNLNTTAFCWFQKVLRLLS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). Strain="SN15". No EST. Prediction made from homology but first and last little exons are uncertain. Peptide signal predicted by SignalP in first exon.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCTCCACCGCTGTTAGCTGTACTTCTGCTCACAAGCGAAGTGAAAGCCCACTTACACAACGAGGTTAGCTTCGAGATAAAAGTCCGAGATGCAAGAGAGCAGAGGCGACAAAGA
TGGACCCG
GTACAGCATCAGCGCCGCAAAGAACAGGAGATCGAGAGGGAGACGTCAAGATGTACCCGTTGATGCTGCTATGCTTTCGAATATTGTAGGCTCGATAGCCGACGGCACTGTT
GTCGGACCTCTCAATCTGCCAGTTGGCGGGAATGAGCCTCCTGTCGTGGATATACAGCAAGGACCACCAGAGATCGAAATACCAGCAGTCGTTGGTGCAGGTACAATCGGAGATCTGCAA
GCAGAAGAGCCGGAAGCAGAATTACCACTGGCGGAGCAACCTGAAGAGGTCTCACCAGAAGAGGAGCTACCAGAAGAGGAGCTACCAGAAGTGGGTGACGACGGACCAGATGGCGGCCTC
ATCGGCGACCTTAACGATGGCATTCTCTCGCCTGAAGGGCAGAACATTGCAGATATTTTGTTGGGGAACGGAAAGACGACTGAAGAGAACTTCGAAATTGGTACTCGACCAGGCTTTGAC
GACCATACAGACTGTGACGGGAAGGATCCATGCTGTAGATGGTACTACATTTCTAAAGACCTTACTGCAGTCTTTCATAACGCCGACGGAACATGTAACAGCCTAGCAAGACAATCGATC
CGAATGGGCTTCCATGACGCTGGAACTTGGTCAGCCAAATTGGCCGCATCTGGAAAGAATAATGGGGGCGCGGATGGCAGTCTAGTGCTTTTCGGAGAATTGAGTCGACCT
GTAAGCGAG
CTCCAACATACACCATCCACGCGATATATGAATTGACTTTGTATACCGGCATAGGAAAATTTCGGTATGGAAGGTGCAGTCGACCTGGCAAGTCGGCTGTATCACACATACAATGTCACA
ATGGCCGATTTGATTCAGTACATGGCAAATCACGCCGTTGTGTCTTGTCCATTGGGGCCCCGCGTCCGGACTTACGTCGGTCGCAAGGACGCGACTGAGGCAGCTCCAGAAGGTCTCTTA
CCAAGTGTCCATGCACCCGCGGACGAGCTGATTGCTCTATTTGCAGACAAAACAATCTCTGCACACGAATTGACAGCACTTATGGGTGCTCATTCTACCTCCACTCAAAGTAATGTCGAT
GCTTCAAAAGCTGGGTATCCGCAAGACACCACCCCTGGCGTATGGGATGTCAATTACTACAATGAAACGCTCGATGCAACAGAGAACGGGTGCATCTTCAAGCTCGAATCAGATGTCAAG
CTTTCGAAACACCCAGCAATGGCGGTCGAGTGGCAAAAATTCGTCGGCGGCCAGGCACACTGGAATGCTGATTATGCGAAAGCTTATCTTCGGTTGTCGCTCCTGGGCGTCAATAACATC
AACGAACTGAAAGAGTGTACGTTGACTTTGCCAGCACAACAAGCAACAGCCCCAAAAGATTCAGACTTAAATGTCAGCGGAAAGTGCACGGCGTCATCTTCGAGTTCACTCATCAGCTCT
TCCACAATTACCATCCCCAACACAACGAACAACCCACTGTCTATAACAGAGATTCTTAATCTGAACACGACAG
GTATCGAAACACTCCCATCAAGTGCAAAAGGCTTCTCAACCCTCAGT
GAGCCGCTACCTCTAGCACCAGAGACCTCGTCTGTGCTCTTGCCAGGCTCTACAATGTCTCTAGAGGAAGCTGTACCCAGTTCTGACATTGCTACGCCGGAAACGACAAGCCTTCTGTTG
GTTTCAGAAAGTCTTGCGTCTTCTGTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCTCCACCGCTGTTAGCTGTACTTCTGCTCACAAGCGAAGTGAAAGCCCACTTACACAACGAGAGCAGAGGCGACAAAGATGGACCCGAAGTGGGTGACGACGGACCAGATGGC
GGCCTCATCGGCGACCTTAACGATGGCATTCTCTCGCCTGAAGGGCAGAACATTGCAGATATTTTGTTGGGGAACGGAAAGACGACTGAAGAGAACTTCGAAATTGGTACTCGACCAGGC
TTTGACGACCATACAGACTGTGACGGGAAGGATCCATGCTGTAGATGGTACTACATTTCTAAAGACCTTACTGCAGTCTTTCATAACGCCGACGGAACATGTAACAGCCTAGCAAGACAA
TCGATCCGAATGGGCTTCCATGACGCTGGAACTTGGTCAGCCAAATTGGCCGCATCTGGAAAGAATAATGGGGGCGCGGATGGCAGTCTAGTGCTTTTCGGAGAATTGAGTCGACCT
GAA
AATTTCGGTATGGAAGGTGCAGTCGACCTGGCAAGTCGGCTGTATCACACATACAATGTCACAATGGCCGATTTGATTCAGTACATGGCAAATCACGCCGTTGTGTCTTGTCCATTGGGG
CCCCGCGTCCGGACTTACGTCGGTCGCAAGGACGCGACTGAGGCAGCTCCAGAAGGTCTCTTACCAAGTGTCCATGCACCCGCGGACGAGCTGATTGCTCTATTTGCAGACAAAACAATC
TCTGCACACGAATTGACAGCACTTATGGGTGCTCATTCTACCTCCACTCAAAGTAATGTCGATGCTTCAAAAGCTGGGTATCCGCAAGACACCACCCCTGGCGTATGGGATGTCAATTAC
TACAATGAAACGCTCGATGCAACAGAGAACGGGTGCATCTTCAAGCTCGAATCAGATGTCAAGCTTTCGAAACACCCAGCAATGGCGGTCGAGTGGCAAAAATTCGTCGGCGGCCAGGCA
CACTGGAATGCTGATTATGCGAAAGCTTATCTTCGGTTGTCGCTCCTGGGCGTCAATAACATCAACGAACTGAAAGAGTGTACGTTGACTTTGCCAGCACAACAAGCAACAGCCCCAAAA
GATTCAGACTTAAATGTCAGCGGAAAGTGCACGGCGTCATCTTCGAGTTCACTCATCAGCTCTTCCACAATTACCATCCCCAACACAACGAACAACCCACTGTCTATAACAGAGATTCTT
AATCTGAACACGACAG
CCTTCTGTTGGTTTCAGAAAGTCTTGCGTCTTCTGTCGTGA

Retrieve as FASTA