Entry information : PnoCIIAC03
Entry ID 6791
Creation 2009-05-14 (Christophe Dunand)
Last sequence changes 2009-05-14 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCIIAC03
Name PnoCIIAC03
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCIIAC03
start..stop
S start..stop
LfluCIIAC01 433 3e-154 1..314 1..324
DexiCIIAC01 419 1e-148 20..314 23..314
LfluCIIAC03 392 5e-138 1..310 1..307
GsteCIIAA03 331 1e-113 1..309 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 512882..513263 382 N° 2 512267..512829 563  
complement(join(512267..512829,512882..513263))


exon

Literature and cross-references PnoCIIAC03
Protein ref. UniProtKB:   Q0UDI2
DNA ref. JGI genome:   scaffold_16 (513263..512267)
mRNA ref. GenBank:   XP_001800412
Protein sequence: PnoCIIAC03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (291)
PWM (Da):   %s   33167.52 (30875.4)  
PI (pH):   %s   7.34 (7.75) Peptide Signal:   %s   cut: 24 range:24-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYPSSLLLLASSAAAFSLPDVSAILPLFSRESGGSSCPSKWNDISKELTSKFLSDGQCNPDARAAIRLIFHECGSWNKAQGAKGGCDGSLILSSEELLRSENKGLEGIAGYIKDRANFYQTSVADMIVFAGNHAVVTCPGGPVVKTFVGRKDSTTAAPDGLLPDVNAPAADLFKLFQDKGFNEVDLAALLGAHSTSNQFNFNTTDGAKGQPQDSTPGVWDVKYYAETLNAPKGVVVFPSDIKLAAHPTVGKEFKGFVNNQGKWNGKFADAMGRMALFGSGTTDGKGLIDCTGALPRATNAKREMRAMPMFACRH

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Sequence with short C-Term (last 3 exons are missing???). complement(join(512267..512829,512882..513263))
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATCCCTCAAGCCTTCTTCTCTTGGCTTCTTCAGCCGCCGCGTTCTCATTACCAGATGTGTCCGCTATCCTCCCATTATTTTCTCGTGAGAGTGGTGGCAGCAGCTGTCCATCCAAG
TGGAATGATATCTCAAAGGAGCTCACTTCCAAATTCTTGTCAGACGGACAGTGCAATCCAGATGCCCGCGCTGCCATCAGGCTGATTTTCCACGAGTGCGGTTCCTGGAACAAAGCACAA
GGTGCGAAAGGTGGCTGCGATGGGAGCCTAATACTCTCATCAGAGGAGTTGTTACGCTCTGAGAACAAGGGCCTCGAAGGCATTGCAGGATACATCAAAGACCGAGCCAACTTCTATCAA
ACCAGCGTCGCAGACATGATTG
GTACGTCTCTGTTTCCCTTTCCTCCTTTCATCTCATACTCACACTGCCTCAGTCTTCGCCGGCAATCACGCAGTCGTCACATGTCCCGGCGGCCCCGT
CGTCAAAACCTTCGTCGGCCGCAAAGACTCCACAACCGCCGCTCCCGACGGCCTCCTTCCTGACGTCAACGCCCCTGCCGCCGACCTCTTCAAACTCTTCCAAGACAAAGGCTTCAACGA
AGTCGATCTTGCCGCCCTACTAGGTGCACACTCCACCTCCAACCAGTTCAACTTCAACACCACCGACGGAGCCAAGGGCCAGCCACAAGACTCCACCCCTGGCGTTTGGGACGTCAAGTA
CTACGCCGAAACACTGAATGCGCCGAAGGGCGTTGTTGTGTTTCCGTCTGACATCAAGTTGGCGGCGCATCCGACTGTGGGCAAGGAGTTCAAGGGATTTGTTAACAACCAAGGGAAGTG
GAATGGGAAGTTCGCTGATGCCATGGGGAGGATGGCGCTATTTGGGAGTGGGACGACGGATGGGAAGGGTCTCATTGATTGCACCGGTGCGTTGCCGAGGGCGACAAATGCGAAGAGGGA
GATGAGGGCTATGCCGATGTTTGCTTGTCGTCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATCCCTCAAGCCTTCTTCTCTTGGCTTCTTCAGCCGCCGCGTTCTCATTACCAGATGTGTCCGCTATCCTCCCATTATTTTCTCGTGAGAGTGGTGGCAGCAGCTGTCCATCCAAG
TGGAATGATATCTCAAAGGAGCTCACTTCCAAATTCTTGTCAGACGGACAGTGCAATCCAGATGCCCGCGCTGCCATCAGGCTGATTTTCCACGAGTGCGGTTCCTGGAACAAAGCACAA
GGTGCGAAAGGTGGCTGCGATGGGAGCCTAATACTCTCATCAGAGGAGTTGTTACGCTCTGAGAACAAGGGCCTCGAAGGCATTGCAGGATACATCAAAGACCGAGCCAACTTCTATCAA
ACCAGCGTCGCAGACATGATTG
TCTTCGCCGGCAATCACGCAGTCGTCACATGTCCCGGCGGCCCCGTCGTCAAAACCTTCGTCGGCCGCAAAGACTCCACAACCGCCGCTCCCGACGGC
CTCCTTCCTGACGTCAACGCCCCTGCCGCCGACCTCTTCAAACTCTTCCAAGACAAAGGCTTCAACGAAGTCGATCTTGCCGCCCTACTAGGTGCACACTCCACCTCCAACCAGTTCAAC
TTCAACACCACCGACGGAGCCAAGGGCCAGCCACAAGACTCCACCCCTGGCGTTTGGGACGTCAAGTACTACGCCGAAACACTGAATGCGCCGAAGGGCGTTGTTGTGTTTCCGTCTGAC
ATCAAGTTGGCGGCGCATCCGACTGTGGGCAAGGAGTTCAAGGGATTTGTTAACAACCAAGGGAAGTGGAATGGGAAGTTCGCTGATGCCATGGGGAGGATGGCGCTATTTGGGAGTGGG
ACGACGGATGGGAAGGGTCTCATTGATTGCACCGGTGCGTTGCCGAGGGCGACAAATGCGAAGAGGGAGATGAGGGCTATGCCGATGTTTGCTTGTCGTCATTAA

Retrieve as FASTA