Entry information : PnoCIIAB04
Entry ID 6792
Creation 2009-05-14 (Christophe Dunand)
Last sequence changes 2011-10-18 (Catherine Mathe)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCIIAB04
Name PnoCIIAB04
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCIIAB04
start..stop
S start..stop
Ssrc1lsm3aCIIAB06 443 7e-159 8..292 8..292
DexiCIIAB01 353 2e-123 8..289 10..293
AalteCIIAB01 352 4e-123 1..263 1..264
ClunCIIAB02 351 1e-122 4..263 2..265
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 381277..381948 672 N° 2 381999..382205 207  
join(381277..381948,381999..382205)


exon

Literature and cross-references PnoCIIAB04
Protein ref. UniProtKB:   Q0U8Y8 [Incorrect prediction]
DNA ref. JGI genome:   scaffold_20 (381277..382205)
Protein sequence: PnoCIIAB04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   292 (275)
PWM (Da):   %s   31051.09 (29256.1)  
PI (pH):   %s   4.74 (4.62) Peptide Signal:   %s   cut: 18 range:18-292
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSRFPILLALIAPTSAFSLWPRQTSSCPAVWTDVAKELQSTFSTCGRAAHGAIRAPFHDCINNGCDGSLILTDECSRSENGGLSFICETLLDLTNKYKVSAADMIQFAAAYAISACPLGPNVKALVGRTDSSVAAPLNSMPSSKDSVDSILAAFSARGFSSDDVVALLGTHSVAIQVVTDPNNVGQPLDSTPAVCDTKYYVETQSGTAPSSLDSDLRMANDTQTAKTWTDFGNSQDLWAAKFVDAWNRFAVIGNDVDSLQDCSSLIPTDSAKKRWAMSMPMGARGYARYHS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="SN15. No EST. Incorrect prediction in UniProt
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCCCGCTTCCCTATCCTCCTTGCTTTGATCGCGCCAACATCAGCCTTCAGTCTCTGGCCGCGTCAAACCAGCAGCTGCCCTGCCGTATGGACAGATGTTGCCAAAGAACTCCAG
AGCACCTTTTCGACATGCGGCAGAGCGGCACATGGAGCTATTCGCGCTCCATTCCATGATTGCATAAACAACGGCTGCGACGGAAGTCTTATTTTGACCGACGAATGTAGTCGCTCTGAG
AACGGTGGCTTGAGCTTCATCTGCGAAACACTCTTGGACCTGACCAACAAGTACAAAGTGAGCGCAGCCGACATGATACAGTTTGCCGCTGCATACGCGATTTCTGCATGCCCACTGGGA
CCAAACGTCAAGGCACTGGTGGGAAGAACCGATAGCTCTGTCGCCGCTCCCTTGAACTCGATGCCCAGTAGCAAAGACTCTGTTGACAGTATCTTGGCTGCATTCAGCGCACGGGGCTTC
TCTTCTGATGATGTTGTTGCCCTGCTAGGCACTCATTCCGTTGCAATCCAAGTTGTGACGGACCCCAACAACGTTGGCCAGCCGCTCGATTCTACGCCGGCTGTATGCGACACCAAATAC
TACGTCGAGACACAGTCTGGAACCGCACCATCCAGCCTGGATAGCGACTTACGGATGGCCAATGACACTCAG
GTAAAATCAACACAGTCTCTCCCAAATTTTGCTGATGCTAACGTTTGT
AGACTGCTAAGACTTGGACGGACTTTGGCAACAGCCAAGATCTTTGGGCTGCCAAATTTGTTGATGCATGGAACCGCTTTGCTGTCATTGGCAACGATGTCGACAGCCTACAAGATTGCT
CGAGTCTGATCCCGACTGACTCTGCGAAGAAGAGGTGGGCAATGAGCATGCCGATGGGTGCGCGCGGTTATGCTAGATATCACTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCCCGCTTCCCTATCCTCCTTGCTTTGATCGCGCCAACATCAGCCTTCAGTCTCTGGCCGCGTCAAACCAGCAGCTGCCCTGCCGTATGGACAGATGTTGCCAAAGAACTCCAG
AGCACCTTTTCGACATGCGGCAGAGCGGCACATGGAGCTATTCGCGCTCCATTCCATGATTGCATAAACAACGGCTGCGACGGAAGTCTTATTTTGACCGACGAATGTAGTCGCTCTGAG
AACGGTGGCTTGAGCTTCATCTGCGAAACACTCTTGGACCTGACCAACAAGTACAAAGTGAGCGCAGCCGACATGATACAGTTTGCCGCTGCATACGCGATTTCTGCATGCCCACTGGGA
CCAAACGTCAAGGCACTGGTGGGAAGAACCGATAGCTCTGTCGCCGCTCCCTTGAACTCGATGCCCAGTAGCAAAGACTCTGTTGACAGTATCTTGGCTGCATTCAGCGCACGGGGCTTC
TCTTCTGATGATGTTGTTGCCCTGCTAGGCACTCATTCCGTTGCAATCCAAGTTGTGACGGACCCCAACAACGTTGGCCAGCCGCTCGATTCTACGCCGGCTGTATGCGACACCAAATAC
TACGTCGAGACACAGTCTGGAACCGCACCATCCAGCCTGGATAGCGACTTACGGATGGCCAATGACACTCAG
ACTGCTAAGACTTGGACGGACTTTGGCAACAGCCAAGATCTTTGGGCT
GCCAAATTTGTTGATGCATGGAACCGCTTTGCTGTCATTGGCAACGATGTCGACAGCCTACAAGATTGCTCGAGTCTGATCCCGACTGACTCTGCGAAGAAGAGGTGGGCAATGAGCATG
CCGATGGGTGCGCGCGGTTATGCTAGATATCACTCATGA

Retrieve as FASTA