Entry information : PnoCIIAB01
Entry ID 6793
Creation 2009-05-14 (Christophe Dunand)
Last sequence changes 2009-05-14 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCIIAB01
Name PnoCIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCIIAB01
start..stop
S start..stop
Ssrc1lsm3aCIIAB01 486 6e-176 27..302 1..277
AalteCIIAB02 439 1e-156 38..302 63..327
CberCIIAB01 434 6e-155 37..302 51..316
DexiCIIAB02 432 3e-154 34..302 51..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 84142..84652 511 N° 2 83696..84090 395  
complement(join(83696..84090,84142..84652))


exon

Literature and cross-references PnoCIIAB01
Protein ref. UniProtKB:   Q0V4B1
DNA ref. JGI genome:   scaffold_2 (84652..83696)
mRNA ref. GenBank:   XM_001791755.1
Protein sequence: PnoCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   302
PWM (Da):   %s   31969.97  
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEDEIQFRYPHIQSEESSACLAWLNDMLTKTRVNKGQETCPPVWKEISTALTAQFLADGQCTDAARAAIRASFHDCFNGACDGSLILADECSRSENRGLERLCGNLGSLAQQKEVGVADLIQFAAAHAIKTCPGGPTVPVKIGRKDSDQANTQGILPGPRAESGDLIKLFASKGFSPIDLAALIGAHTTAKQRISDPAQAGASLDSTVGTWDNKYYSETKNGGAPFTLPADKSISQNPITAIPFGTFAISKGAWDFAFVAAMTKMSMLGVNGAGLVDCTSALPGGSRKREIRSSNLFDRLK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 introns). No EST. Sequence with short C-Term (last 3 exons are missing???).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGATGAAATTCAGTTCAGGTACCCACACATACAAAGCGAGGAATCATCAGCATGTTTGGCCTGGCTCAACGATATGTTGACCAAAACGAGAGTCAACAAAGGACAAGAGACCTGT
CCACCAGTCTGGAAAGAGATCTCAACTGCCCTCACTGCTCAATTTCTGGCAGATGGTCAATGCACAGACGCCGCCCGCGCCGCCATCCGAGCATCCTTCCACGACTGCTTCAATGGTGCT
TGCGATGGCTCATTGATTCTTGCCGACGAGTGTTCCCGCTCGGAGAACAGAGGTCTTGAACGACTTTGTGGCAACCTCGGAAGTTTGGCGCAGCAGAAAGAGGTCGGAGTTGCAGACCTC
ATCCAGTTCGCTGCGGCCCATGCCATCAAGACATGTCCTGGAGGCCCGACAGTACCTGTCAAGATTGGTCGTAAAGACTCGGATCAGGCAAACACGCAGGGTATACTTCCTGGACCTCGT
GCAGAGAGTGGTGATCTCATTAAGCTTTTCG
GTAAGCAAAGCATGTCTGTTCTGATCAGCAATGACTGACCACATTTCCTAGCATCGAAGGGTTTCTCTCCAATCGATCTCGCTGCTCTT
ATTGGCGCCCACACAACTGCTAAGCAACGTATCTCCGACCCCGCTCAGGCCGGCGCATCGCTTGACTCAACCGTCGGTACCTGGGATAACAAGTACTACTCGGAGACAAAGAACGGCGGA
GCACCTTTCACCCTCCCAGCGGACAAGAGCATTTCGCAAAATCCTATTACCGCGATCCCATTCGGCACCTTCGCCATCAGTAAGGGTGCGTGGGACTTTGCGTTCGTTGCTGCTATGACT
AAGATGAGCATGCTGGGCGTGAATGGTGCAGGTCTTGTCGACTGCACAAGCGCGCTGCCTGGCGGTAGCAGGAAGCGTGAGATCAGGAGCAGCAATTTGTTTGATCGATTGAAGTGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGATGAAATTCAGTTCAGGTACCCACACATACAAAGCGAGGAATCATCAGCATGTTTGGCCTGGCTCAACGATATGTTGACCAAAACGAGAGTCAACAAAGGACAAGAGACCTGT
CCACCAGTCTGGAAAGAGATCTCAACTGCCCTCACTGCTCAATTTCTGGCAGATGGTCAATGCACAGACGCCGCCCGCGCCGCCATCCGAGCATCCTTCCACGACTGCTTCAATGGTGCT
TGCGATGGCTCATTGATTCTTGCCGACGAGTGTTCCCGCTCGGAGAACAGAGGTCTTGAACGACTTTGTGGCAACCTCGGAAGTTTGGCGCAGCAGAAAGAGGTCGGAGTTGCAGACCTC
ATCCAGTTCGCTGCGGCCCATGCCATCAAGACATGTCCTGGAGGCCCGACAGTACCTGTCAAGATTGGTCGTAAAGACTCGGATCAGGCAAACACGCAGGGTATACTTCCTGGACCTCGT
GCAGAGAGTGGTGATCTCATTAAGCTTTTCG
CATCGAAGGGTTTCTCTCCAATCGATCTCGCTGCTCTTATTGGCGCCCACACAACTGCTAAGCAACGTATCTCCGACCCCGCTCAGGCC
GGCGCATCGCTTGACTCAACCGTCGGTACCTGGGATAACAAGTACTACTCGGAGACAAAGAACGGCGGAGCACCTTTCACCCTCCCAGCGGACAAGAGCATTTCGCAAAATCCTATTACC
GCGATCCCATTCGGCACCTTCGCCATCAGTAAGGGTGCGTGGGACTTTGCGTTCGTTGCTGCTATGACTAAGATGAGCATGCTGGGCGTGAATGGTGCAGGTCTTGTCGACTGCACAAGC
GCGCTGCCTGGCGGTAGCAGGAAGCGTGAGATCAGGAGCAGCAATTTGTTTGATCGATTGAAGTGG

Retrieve as FASTA