Entry information : VaaCIIAA02
Entry ID 6812
Creation 2009-05-18 (Christophe Dunand)
Last sequence changes 2017-05-04 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-04 (Catherine Mathe)
Peroxidase information: VaaCIIAA02
Name VaaCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Verticillium
Organism Verticillium albo-atrum    [TaxId: 27335 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VaaCIIAA02
start..stop
S start..stop
VdaCIIAA02 801 0 1..399 1..399
AalcCIIAA 498 4e-177 5..399 6..394
CfioCIIAA03_MH18 437 3e-153 1..398 1..401
CgloCIIAA01_ST23 437 4e-153 1..388 1..391
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10247..11233 987 N° 2 11296..11508 213  
join(10247..11233,11296..11508)


exon

Literature and cross-references VaaCIIAA02
DNA ref. GenBank:   ABPE01000542.1 (10247..11508)
Protein sequence: VaaCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   399 (382)
PWM (Da):   %s   43450.75 (41664.7)  
PI (pH):   %s   8.55 (8.38) Peptide Signal:   %s   cut: 18 range:18-399
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFSIVLVALTAGASIAHPGMSKAMADIQEIQSRNGRSGPSTEIIGDLVGLDDRRLTATGRDIKNILSGRGNPQNTVASYWLGAPRLGGLFCRMDQCCVWKHIANEMRGMMIGDASRCNNLARASIRLGFHDAATWSKDTGGTGADGSIVLTAECARVPENNGLAEVCAQMKTWHDKYKGYGVSMADLIQFAANVATVSCPLGPRIKTYIGRKDNAVEPPRNLLPSPFHSADRLLQLFADKTFTADGLIALMGAHSTSQQRFVNRTRPGDPQDSTPGVWDVKYYGETIDANAPQRVFKFQSDVNLANDARTRAAWESFIPESSQGAWNHAYAAEYVRMSLLGVYNINSLTDCTKALPPFQRSYSSSDESVIDRFMHGLIGSVQKVKDLLLKGDKVPSNI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCCATTGTACTGGTTGCCTTGACGGCTGGTGCCTCCATTGCTCATCCGGGTATGAGCAAGGCAATGGCTGATATTCAAGAGATTCAATCACGAAATGGCCGCTCCGGACCC
TCGACCGAGATCATCGGTGACCTGGTGGGCCTTGATGACAGGCGGCTGACTGCCACCGGCCGAGATATCAAGAACATCCTAAGCGGCCGCGGTAACCCCCAAAATACCGTGGCTAGCTAC
TGGCTGGGTGCCCCTCGTCTTGGGGGTCTCTTCTGCCGCATGGACCAGTGTTGTGTGTGGAAACACATTGCCAACGAGATGCGCGGCATGATGATCGGAGATGCAAGTCGGTGCAACAAT
CTTGCACGTGCCTCCATCCGTCTTGGCTTCCACGACGCCGCCACCTGGTCCAAGGACACCGGAGGCACCGGTGCCGACGGGTCGATCGTCCTGACGGCCGAATGTGCCCGCGTTCCCGAA
AATAACGGCCTTGCTGAGGTTTGCGCTCAAATGAAGACGTGGCACGACAAGTACAAGGGCTACGGCGTCTCCATGGCCGACCTCATCCAGTTCGCCGCCAACGTAGCCACCGTGTCGTGC
CCGCTCGGTCCGCGTATCAAGACTTATATCGGCCGTAAAGACAACGCCGTTGAACCCCCACGCAACCTCCTTCCCAGCCCTTTCCACAGCGCAGACCGCCTGCTCCAGCTCTTCGCGGAC
AAGACCTTTACAGCGGATGGCCTGATTGCCCTCATGGGCGCCCACTCCACGAGCCAGCAGCGATTCGTCAACCGTACCCGCCCCGGTGATCCCCAGGACTCTACGCCTGGCGTGTGGGAT
GTCAAGTACTACGGCGAGACTATTGATGCCAACGCACCCCAGCGTGTTTTCAAGTTTCAAAGCGACGTCAACCTCGCCAACGACGCACGCACACGCGCTGCCTGGGAGTCGTTCATCCCC
GAGTCATCCCAGGGCGCCTGGAACCAT
GTACGTTGTTTTGTGCCCGCCTATCTACCGTTCGATGCTTTACCCGTACTGACCTGAGACAGGCTTACGCTGCCGAGTATGTCCGCATGTCGC
TCCTCGGCGTGTACAACATCAACAGTCTCACCGATTGCACCAAGGCGCTGCCTCCGTTCCAGCGCAGCTACAGCTCGTCAGACGAGTCTGTCATCGACCGCTTCATGCACGGACTGATTG
GGAGCGTGCAAAAAGTCAAGGACCTTCTGCTGAAAGGAGACAAGGTTCCCAGTAATATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCCATTGTACTGGTTGCCTTGACGGCTGGTGCCTCCATTGCTCATCCGGGTATGAGCAAGGCAATGGCTGATATTCAAGAGATTCAATCACGAAATGGCCGCTCCGGACCC
TCGACCGAGATCATCGGTGACCTGGTGGGCCTTGATGACAGGCGGCTGACTGCCACCGGCCGAGATATCAAGAACATCCTAAGCGGCCGCGGTAACCCCCAAAATACCGTGGCTAGCTAC
TGGCTGGGTGCCCCTCGTCTTGGGGGTCTCTTCTGCCGCATGGACCAGTGTTGTGTGTGGAAACACATTGCCAACGAGATGCGCGGCATGATGATCGGAGATGCAAGTCGGTGCAACAAT
CTTGCACGTGCCTCCATCCGTCTTGGCTTCCACGACGCCGCCACCTGGTCCAAGGACACCGGAGGCACCGGTGCCGACGGGTCGATCGTCCTGACGGCCGAATGTGCCCGCGTTCCCGAA
AATAACGGCCTTGCTGAGGTTTGCGCTCAAATGAAGACGTGGCACGACAAGTACAAGGGCTACGGCGTCTCCATGGCCGACCTCATCCAGTTCGCCGCCAACGTAGCCACCGTGTCGTGC
CCGCTCGGTCCGCGTATCAAGACTTATATCGGCCGTAAAGACAACGCCGTTGAACCCCCACGCAACCTCCTTCCCAGCCCTTTCCACAGCGCAGACCGCCTGCTCCAGCTCTTCGCGGAC
AAGACCTTTACAGCGGATGGCCTGATTGCCCTCATGGGCGCCCACTCCACGAGCCAGCAGCGATTCGTCAACCGTACCCGCCCCGGTGATCCCCAGGACTCTACGCCTGGCGTGTGGGAT
GTCAAGTACTACGGCGAGACTATTGATGCCAACGCACCCCAGCGTGTTTTCAAGTTTCAAAGCGACGTCAACCTCGCCAACGACGCACGCACACGCGCTGCCTGGGAGTCGTTCATCCCC
GAGTCATCCCAGGGCGCCTGGAACCAT
GCTTACGCTGCCGAGTATGTCCGCATGTCGCTCCTCGGCGTGTACAACATCAACAGTCTCACCGATTGCACCAAGGCGCTGCCTCCGTTCCAG
CGCAGCTACAGCTCGTCAGACGAGTCTGTCATCGACCGCTTCATGCACGGACTGATTGGGAGCGTGCAAAAAGTCAAGGACCTTCTGCTGAAAGGAGACAAGGTTCCCAGTAATATCTAG

Retrieve as FASTA