Entry information : MfiCIIAC02
Entry ID 6826
Creation 2009-05-22 (Christophe Dunand)
Last sequence changes 2009-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MfiCIIAC02
Name MfiCIIAC02
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella fijiensis (Pseudocercospora fijiensis)    [TaxId: 83344 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MfiCIIAC02
start..stop
S start..stop
CfulCIIAC01 418 5e-148 6..318 18..329
MpiCIIAC01 391 2e-137 1..318 1..319
MfiCIIAC01 369 4e-129 50..317 39..307
BcomCIIAC01 320 1e-109 3..317 4..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 857163..857856 694 N° 2 856950..857105 156 N° 3 856792..856898 107  
complement(join(856792..856898,856950..857105,857163..857856))


exon

Literature and cross-references MfiCIIAC02
DNA ref. JGI genome:   scaffold_12 (857856..856792)
mRNA ref. JGI transcript:   60146
EST ref. GenBank:   FD675082.1 [5' end]   FD675081.1 [3' end]
Protein sequence: MfiCIIAC02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (296)
PWM (Da):   %s   33393.71 (31126.5)  
PI (pH):   %s   8.11 (7.85) Peptide Signal:   %s   cut: 23 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALRSLTFGVAALLLAHNLCTAATVSSIGNSKPLDPRSPASTLTASQSSCPLVWSVVAEDLKRSFSGCNDLARSAIRFAFHDAAGYSVKNPVIAPASGGADGSLLLNDGEISRGDNAPMKQNYRDPFLLPKYLTYKSQGVSAADLVQFAGSVGIKSCRGGPTVKTVVGRKESSAASPGGLLPQAFGKGSDYNTLIKLWKDKTFSPRELAALMGAHTVSVSLTEQANGIPFGGAQDSDPTVWDNHYYSQTQSRTRGVYSFASDVNLSNATTECGKAFTAFANDQATWTSEFAAAMYKLSVLGIPQSVVDNFVDCTSLIS

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGAGGTCCCTGACCTTCGGTGTCGCCGCATTGCTGCTCGCACACAATCTTTGCACGGCGGCCACAGTGTCTTCAATAGGCAACTCGAAACCCCTTGATCCACGGAGCCCAGCA
AGCACTTTAACGGCGTCACAGTCATCCTGCCCACTAGTCTGGAGCGTAGTGGCAGAGGATCTCAAACGGTCTTTCTCAGGCTGTAATGACCTCGCCCGATCCGCCATTCGATTCGCCTTT
CACGATGCAGCTGGTTATTCGGTCAAAAACCCCGTCATCGCTCCAGCTTCTGGAGGTGCAGACGGCTCTCTCCTCCTGAATGACGGAGAGATATCCAGAGGCGATAACGCTCCCATGAAG
CAGAATTATCGCGATCCGTTCCTGCTGCCGAAATACCTTACATACAAGAGCCAGGGCGTGAGCGCAGCAGATCTCGTCCAATTTGCAGGGAGTGTGGGAATCAAAAGCTGCCGAGGAGGT
CCAACAGTAAAGACCGTGGTAGGGAGGAAGGAATCCAGCGCAGCTTCTCCAGGAGGACTTCTGCCGCAAGCATTTGGGAAGGGATCCGATTACAATACTTTGATCAAGCTCTGGAAAGAT
AAAACCTTCAGTCCGAGGGAACTTGCGGCTTTGATGGGTGCTCACACAGTGAGCGTTTCGCTCACGGAGCAGGCGAACGGCATTCCATTCGGAG
GTGAGTGAACAAGTGTCTGCCGTTCC
GGAAGTATCGGACAATTAACTTCATATGCAGGTGCGCAAGACTCCGACCCGACTGTTTGGGATAACCATTACTACAGCCAGACCCAATCTCGTACTCGTGGCGTGTACAGCTTCGCTTCG
GACGTCAACCTTTCCAATGCTACCACGGAGTGTGGCAAAGCGTTCACGGCGTTTGCGAACGATCAAG
GTAGGTGATGATCGAGGGAACAGTAGGTCATATTTGCTGATATTGGTGCAGCA
ACCTGGACGTCCGAGTTCGCTGCAGCCATGTACAAGCTTAGCGTGCTTGGTATCCCTCAAAGTGTGGTGGACAACTTTGTGGACTGCACCTCACTCATCTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGAGGTCCCTGACCTTCGGTGTCGCCGCATTGCTGCTCGCACACAATCTTTGCACGGCGGCCACAGTGTCTTCAATAGGCAACTCGAAACCCCTTGATCCACGGAGCCCAGCA
AGCACTTTAACGGCGTCACAGTCATCCTGCCCACTAGTCTGGAGCGTAGTGGCAGAGGATCTCAAACGGTCTTTCTCAGGCTGTAATGACCTCGCCCGATCCGCCATTCGATTCGCCTTT
CACGATGCAGCTGGTTATTCGGTCAAAAACCCCGTCATCGCTCCAGCTTCTGGAGGTGCAGACGGCTCTCTCCTCCTGAATGACGGAGAGATATCCAGAGGCGATAACGCTCCCATGAAG
CAGAATTATCGCGATCCGTTCCTGCTGCCGAAATACCTTACATACAAGAGCCAGGGCGTGAGCGCAGCAGATCTCGTCCAATTTGCAGGGAGTGTGGGAATCAAAAGCTGCCGAGGAGGT
CCAACAGTAAAGACCGTGGTAGGGAGGAAGGAATCCAGCGCAGCTTCTCCAGGAGGACTTCTGCCGCAAGCATTTGGGAAGGGATCCGATTACAATACTTTGATCAAGCTCTGGAAAGAT
AAAACCTTCAGTCCGAGGGAACTTGCGGCTTTGATGGGTGCTCACACAGTGAGCGTTTCGCTCACGGAGCAGGCGAACGGCATTCCATTCGGAG
GTGCGCAAGACTCCGACCCGACTGTT
TGGGATAACCATTACTACAGCCAGACCCAATCTCGTACTCGTGGCGTGTACAGCTTCGCTTCGGACGTCAACCTTTCCAATGCTACCACGGAGTGTGGCAAAGCGTTCACGGCGTTTGCG
AACGATCAAG
CAACCTGGACGTCCGAGTTCGCTGCAGCCATGTACAAGCTTAGCGTGCTTGGTATCCCTCAAAGTGTGGTGGACAACTTTGTGGACTGCACCTCACTCATCTCTTGA

Retrieve as FASTA