Entry information : PcLiP06_RP78 (PcLiPF_RP78)
Entry ID 6834
Creation 2009-05-29 (Christophe Dunand)
Last sequence changes 2011-09-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-11-23 (Christophe Dunand)
Peroxidase information: PcLiP06_RP78 (PcLiPF_RP78)
Name (synonym) PcLiP06_RP78 (PcLiPF_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP06_RP78
start..stop
S start..stop
PcLiP06 748 0 1..372 1..372
PsoLiP07 671 0 1..372 1..373
PcLiP09_RP78 664 0 1..372 1..372
PcLiP09_ME446 658 0 1..372 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1444920..1444980 61 N° 2 1445031..1445184 154 N° 3 1445243..1445299 57 N° 4 1445349..1445563 215
N° 5 1445614..1445655 42 N° 6 1445707..1445785 79 N° 7 1445838..1446079 242 N° 8 1446138..1446319 182
N° 9 1446373..1446437 65 N° 10 1446495..1446516 22  
join(1444920..1444980,1445031..1445184,1445243..1445299,1445349..1445563,1445614 ..1445655,1445707..1445785,1445838..1446079,1446138..1446319,1446373..1446437,14 46495..1446516)


exon

Literature and cross-references PcLiP06_RP78 (PcLiPF_RP78)
DNA ref. JGI genome:   scaffold_9 (1444920..1446516)
mRNA ref. JGI transcript:   122202
Protein sequence: PcLiP06_RP78 (PcLiPF_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (351)
PWM (Da):   %s   39204.14 (37184.0)  
PI (pH):   %s   4.1 (4.05) Peptide Signal:   %s   cut: 22 range:22-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKQLAAAVALALSIQAAQGAAVKEKRATCSNGATVGDASCCAWFDVLDDIQQNLFNGAQCGAEAHESIRLVFHDAIAISPALESQGKFGGGGADGSIILFDDIETNFHPNIGLDEIVNLQKPFIQKHGVTPGDFIAFAGAVAMSNCPGAPQMNFFTGRAATQAAPDGLVPEPFHTVDQIISRVNDAGEFDELELVWMLSAHSVAAANDVDPTIQGLPFDSTPGVFDSQFFVETQLRGTAFPGSGGNQGEVESPLPGEMRLQSDSSIARDSRTACEWQSFNNQSKLVSDFQFIFLALTQLGQNPDAMTDCSDVIPISKPVPNNVPFSFFPAGKTMADVEQCAETPFPTLTTLPGPETSVQRIQPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCAAGCAACTCGCTGCTGCCGTCGCTCTCGCACTCTCGATCCAGGCTGCTCAAGGTGCGGCATCTACTCCACATCCTTGTCCCCCCGTACTGACTTCGATGCAGGCGCTGCCG
TGAAGGAGAAGCGTGCCACCTGTTCCAACGGCGCGACTGTCGGCGACGCGTCGTGCTGCGCCTGGTTCGACGTTCTCGACGACATCCAGCAGAACCTCTTCAACGGCGCCCAATGTGGTG
CTGAGGCTCATGAGTCCATCCGCCT
GTCAGTGCCTCCATACCGCTTCATTCGGTTGAGTGTTCAAACTCACCTGCGTCTCCAGCGTCTTCCATGACGCCATCGCTATCTCGCCTGCCCTT
GAGTCTCAAGGCAAATTCGG
GTGCGTCCTCTCTCCGTTTGACTGCAGGGAGTCGCTGAGTGTAGCATAGTGGTGGAGGCGCTGATGGCTCCATTATCCTCTTCGACGATATCGAGACCAA
CTTCCACCCAAACATCGGCCTTGACGAGATTGTCAACCTGCAGAAGCCCTTCATCCAGAAGCACGGCGTTACTCCTGGCGATTTCATTGCCTTTGCTGGCGCCGTCGCCATGAGCAACTG
CCCTGGTGCTCCGCAGATGAACTTCTTCACCGGTCGTGCTCCTG
GTATGTGTTGAGCACCCCAGCGTGGAATCAGTCTGACACTTGTCCTGCAGCTACTCAGGCCGCTCCAGACGGTCTC
GTTCCCGAGCCATTCC
GTACGTCAGCTGCACAGATACGCATACCCACCCGCTGACCGACTCTTACAGACACTGTCGACCAGATCATCTCTCGCGTCAACGACGCTGGCGAGTTTGACGAG
CTTGAGCTCGTCTGGATGCTGTCTGC
GTAAGTTGCAATCCGGCTGTTCTACACTGACAGAGCTGACCACACGCCACAGTCACTCCGTCGCTGCGGCGAACGATGTCGATCCGACGATCCA
GGGCTTGCCGTTCGACTCGACCCCGGGTGTCTTCGACTCGCAGTTCTTCGTTGAGACACAGCTTCGCGGCACGGCGTTCCCCGGCTCGGGTGGCAACCAGGGTGAGGTTGAATCCCCTCT
CCCCGGTGAGATGCGCCTCCAGTCCGACTCCTCGATCGCCCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCCTTCGTCA
GTGCGTACCACATGTACAATTCTAGCGCGAGTGGGCGGAC
GCTGACTTTGCGCCGTAGACAACCAGTCGAAGCTCGTCAGCGACTTCCAGTTCATCTTCCTCGCCCTTACCCAGCTCGGCCAGAACCCGGATGCCATGACGGACTGCTCTGACGTGATCC
CGATCTCGAAGCCGGTCCCCAACAACGTTCCATTCTCGTTCTTCCCCGCTGGCAAGACCATGGCTGATGTTGAGCAGGCG
GTGCGTACCAATTCACGTCTACCACACTTATGCTGTGGCT
AACTTATGCGCAGTGTGCTGAGACGCCCTTCCCGACTCTGACGACGCTTCCTGGCCCCGAGACCTCCGTCCAGCGCATGTAAGTACTTCCAAGGTGACAGCGTACCAATATCAAGACACT
AATGATCCACTGCAGTCAGCCTCCTCCGGGTGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCAAGCAACTCGCTGCTGCCGTCGCTCTCGCACTCTCGATCCAGGCTGCTCAAGGCGCTGCCGTGAAGGAGAAGCGTGCCACCTGTTCCAACGGCGCGACTGTCGGCGACGCG
TCGTGCTGCGCCTGGTTCGACGTTCTCGACGACATCCAGCAGAACCTCTTCAACGGCGCCCAATGTGGTGCTGAGGCTCATGAGTCCATCCGCCT
CGTCTTCCATGACGCCATCGCTATC
TCGCCTGCCCTTGAGTCTCAAGGCAAATTCGG
TGGTGGAGGCGCTGATGGCTCCATTATCCTCTTCGACGATATCGAGACCAACTTCCACCCAAACATCGGCCTTGACGAGATTGTCAAC
CTGCAGAAGCCCTTCATCCAGAAGCACGGCGTTACTCCTGGCGATTTCATTGCCTTTGCTGGCGCCGTCGCCATGAGCAACTGCCCTGGTGCTCCGCAGATGAACTTCTTCACCGGTCGT
GCTCCTG
CTACTCAGGCCGCTCCAGACGGTCTCGTTCCCGAGCCATTCCACACTGTCGACCAGATCATCTCTCGCGTCAACGACGCTGGCGAGTTTGACGAGCTTGAGCTCGTCTGGATG
CTGTCTGC
TCACTCCGTCGCTGCGGCGAACGATGTCGATCCGACGATCCAGGGCTTGCCGTTCGACTCGACCCCGGGTGTCTTCGACTCGCAGTTCTTCGTTGAGACACAGCTTCGCGGC
ACGGCGTTCCCCGGCTCGGGTGGCAACCAGGGTGAGGTTGAATCCCCTCTCCCCGGTGAGATGCGCCTCCAGTCCGACTCCTCGATCGCCCGCGACTCGCGCACGGCGTGCGAGTGGCAG
TCCTTCGTCA
ACAACCAGTCGAAGCTCGTCAGCGACTTCCAGTTCATCTTCCTCGCCCTTACCCAGCTCGGCCAGAACCCGGATGCCATGACGGACTGCTCTGACGTGATCCCGATCTCG
AAGCCGGTCCCCAACAACGTTCCATTCTCGTTCTTCCCCGCTGGCAAGACCATGGCTGATGTTGAGCAGGCG
TGTGCTGAGACGCCCTTCCCGACTCTGACGACGCTTCCTGGCCCCGAG
ACCTCCGTCCAGCGCAT
TCAGCCTCCTCCGGGTGCCTAA

Retrieve as FASTA