Entry information : PcLiP03_RP78 (PcLiPC_RP78)
Entry ID 6835
Creation 2009-05-29 (Christophe Dunand)
Last sequence changes 2011-09-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-11-24 (Christophe Dunand)
Peroxidase information: PcLiP03_RP78 (PcLiPC_RP78)
Name (synonym) PcLiP03_RP78 (PcLiPC_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP03_RP78
start..stop
S start..stop
PcLiP03_BKMF1767 731 0 1..372 1..371
PsoLiP03 665 0 1..372 1..372
PsoLiP07 624 0 1..372 1..373
PcarLiPC 616 0 1..372 1..371
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 394691..394751 61 N° 2 394487..394637 151 N° 3 394378..394434 57 N° 4 394111..394325 215
N° 5 394019..394060 42 N° 6 393888..393966 79 N° 7 393710..393835 126 N° 8 393360..393660 301
N° 9 393233..393297 65 N° 10 393154..393175 22  
complement(join(393154..393175,393233..393297,393360..393660,393710..393835,3938 88..393966,394019..394060,394111..394325,394378..394434,394487..394637,394691..3 94751))


exon

Literature and cross-references PcLiP03_RP78 (PcLiPC_RP78)
DNA ref. JGI genome:   scaffold_19 (394751..393154)
mRNA ref. JGI transcript:   131738
Protein sequence: PcLiP03_RP78 (PcLiPC_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (351)
PWM (Da):   %s   39241.18 (37086.9)  
PI (pH):   %s   4.15 (4.02) Peptide Signal:   %s   cut: 22 range:22-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKKLLAVLTAALSLRAAQGAAVEKRATCSNGKVVPAASCCTWFNVLSDIQENLFNGGQCGAEAHESIRLVFHDAIAISPAMEAAGQFGGGGADGSIMIFDEIETNFHPNIGLDEIVRLQKPFVQKHGVTPGDFIAFAGAVALSNCPGAPQMNFFTGRAATQPAPDGLVPEPFHSVDQIIDRVFDAGEFDELELVWMLSAHSVAAANDIDPNIQGLPFDSTPGIFDSQFFVETQLAGTGFTGGSNNQGEVSSPLPGEMRLQSDFLIARDARTACEWQSFVNNQSKLVSDFQFIFLALTQLGQDPDAMTDCSAVIPISKPAPNNTPGFSFFPPGMTMDDVEQCAETPFPTLSTLPGPATSVARIPPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAAGCTCCTTGCTGTTCTTACCGCCGCTCTCTCCCTCCGTGCTGCTCAGGGTGCGTCCCGGATGGCTACCGACGCATTGCCCAAACTAACAGCTACGCGATAGGTGCGG
CCGTTGAGAAGCGCGCGACTTGCTCGAACGGCAAGGTCGTCCCCGCGGCGTCCTGCTGCACCTGGTTCAACGTTCTGTCCGATATCCAGGAGAACCTCTTCAATGGCGGCCAGTGTGGCG
CCGAGGCTCATGAGTCGATCCGTCT
GTAAGCATACTGTTACTCGCCGCACAGTGCTTGCCTCTTAACGCCGCCCTAGCGTCTTCCACGACGCCATCGCTATCTCTCCCGCTATGGAGGCC
GCAGGCCAGTTCGG
GTGTGTATCCATCGGCTTCTGCACTGGCATGGAGCTTGACCGTGGACGTTAGTGGCGGAGGCGCCGATGGTTCTATCATGATCTTCGACGAGATCGAGACCAACTT
CCATCCCAACATCGGTCTCGACGAGATCGTCCGCCTGCAGAAGCCGTTCGTCCAGAAGCACGGTGTCACTCCCGGTGACTTCATCGCCTTCGCTGGCGCGGTGGCGCTCAGTAACTGCCC
CGGTGCTCCGCAGATGAACTTCTTCACTGGTCGTGCTCCGG
GTACGTTGCAAAATGCGGAATTGATACAATGTTACTCATTTCGAGGACAGCAACTCAGCCAGCCCCTGACGGCCTCGTC
CCAGAGCCCTTCC
GTACGTCGAATCATCCTGTGACCTCTCATCAATATACTGACAAATCCTGCAGACTCTGTTGACCAAATCATCGACCGTGTCTTCGATGCCGGTGAATTCGATGAGCT
CGAGCTCGTCTGGATGCTCTCTGC
GTTAGTGTCTCCTGGAGCCCTTGTTTTCATGCACTGACCAGTTTCGCTACAGACACTCCGTCGCGGCTGCCAACGATATCGACCCGAACATCCAGG
GCTTGCCCTTCGACTCGACCCCCGGTATTTTCGATTCCCAGTTCTTCGTCGAGACTCAGCTTGCTGGCACCGGCTTCACTGG
GTTGGTACTTTATCACTTGCGCTGGACCGCGGGCTGAT
CGTTCTCGCAGCGGTTCTAACAACCAGGGCGAAGTTTCCTCCCCGCTTCCAGGCGAGATGCGTCTCCAGTCTGACTTCCTGATCGCTCGCGACGCGCGCACCGCTTGCGAGTGGCAGTCG
TTCGTCAACAACCAGTCCAAGCTCGTCTCCGACTTCCAGTTCATCTTCCTCGCCCTCACTCAGCTCGGCCAGGACCCGGATGCGATGACCGACTGCTCTGCTGTCATCCCCATCTCCAAG
CCCGCCCCGAACAACACCCCCGGATTCTCCTTCTTCCCGCCCGGCATGACGATGGACGATGTCGAGCAGGCT
GTACGTTCCACCGTCCCCCCACACTGATACAGGACTCCCTGACTGACG
ATCCTTATGTTTAGTGCGCCGAGACGCCCTTCCCGACTCTCTCGACTCTCCCTGGCCCTGCGACCTCCGTCGCTCGCATGTGGGTACCTCTAGCCCTCTGGTGGCGGTATATGAGCTGAT
TACGAATGATATCTAGCCCTCCTCCTCCTGGTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAAGCTCCTTGCTGTTCTTACCGCCGCTCTCTCCCTCCGTGCTGCTCAGGGTGCGGCCGTTGAGAAGCGCGCGACTTGCTCGAACGGCAAGGTCGTCCCCGCGGCGTCC
TGCTGCACCTGGTTCAACGTTCTGTCCGATATCCAGGAGAACCTCTTCAATGGCGGCCAGTGTGGCGCCGAGGCTCATGAGTCGATCCGTCT
CGTCTTCCACGACGCCATCGCTATCTCT
CCCGCTATGGAGGCCGCAGGCCAGTTCGG
TGGCGGAGGCGCCGATGGTTCTATCATGATCTTCGACGAGATCGAGACCAACTTCCATCCCAACATCGGTCTCGACGAGATCGTCCGCCTG
CAGAAGCCGTTCGTCCAGAAGCACGGTGTCACTCCCGGTGACTTCATCGCCTTCGCTGGCGCGGTGGCGCTCAGTAACTGCCCCGGTGCTCCGCAGATGAACTTCTTCACTGGTCGTGCT
CCGG
CAACTCAGCCAGCCCCTGACGGCCTCGTCCCAGAGCCCTTCCACTCTGTTGACCAAATCATCGACCGTGTCTTCGATGCCGGTGAATTCGATGAGCTCGAGCTCGTCTGGATGCTC
TCTGC
ACACTCCGTCGCGGCTGCCAACGATATCGACCCGAACATCCAGGGCTTGCCCTTCGACTCGACCCCCGGTATTTTCGATTCCCAGTTCTTCGTCGAGACTCAGCTTGCTGGCACC
GGCTTCACTGG
CGGTTCTAACAACCAGGGCGAAGTTTCCTCCCCGCTTCCAGGCGAGATGCGTCTCCAGTCTGACTTCCTGATCGCTCGCGACGCGCGCACCGCTTGCGAGTGGCAGTCG
TTCGTCAACAACCAGTCCAAGCTCGTCTCCGACTTCCAGTTCATCTTCCTCGCCCTCACTCAGCTCGGCCAGGACCCGGATGCGATGACCGACTGCTCTGCTGTCATCCCCATCTCCAAG
CCCGCCCCGAACAACACCCCCGGATTCTCCTTCTTCCCGCCCGGCATGACGATGGACGATGTCGAGCAGGCT
TGCGCCGAGACGCCCTTCCCGACTCTCTCGACTCTCCCTGGCCCTGCG
ACCTCCGTCGCTCGCAT
CCCTCCTCCTCCTGGTGCTTAA

Retrieve as FASTA