Entry information : PcLiP08_RP78 (PcLiPH_RP78)
Entry ID 6836
Creation 2009-05-29 (Christophe Dunand)
Last sequence changes 2011-11-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-02-12 (Christophe Dunand)
Peroxidase information: PcLiP08_RP78 (PcLiPH_RP78)
Name (synonym) PcLiP08_RP78 (PcLiPH_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP08_RP78
start..stop
S start..stop
PcLiP07_RF78 662 0 1..368 1..372
PcLiP01_RP78 662 0 1..368 1..372
PcLiP08_BKMF1767 661 0 1..368 1..372
PsoLiP07 658 0 1..368 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 454867..454927 61 N° 2 454657..454810 154 N° 3 454546..454602 57 N° 4 454271..454485 215
N° 5 452425..452454 30 N° 6 452290..452368 79 N° 7 451817..452240 424 N° 8 451700..451764 65
N° 9 451627..451648 22  
complement(join(451627..451648,451700..451764,451817..452240,452290..452368,4524 25..452454,454271..454485,454546..454602,454657..454810,454867..454927))


exon

Literature and cross-references PcLiP08_RP78 (PcLiPH_RP78)
DNA ref. JGI genome:   scaffold_19 (454927..451627)
Protein sequence: PcLiP08_RP78 (PcLiPH_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368 (347)
PWM (Da):   %s   39101.17 (36982.0)  
PI (pH):   %s   4.22 (4.18) Peptide Signal:   %s   cut: 22 range:22-368
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFAAISLALSLSAANAVAVKEKRATCANGVTVGDASCCAWFDVLDDIQENLFHGGQCGAEAHESIRLVFHDSIAISPAMEAQGKFGGGGADGSIMIFDDIETAFHPNIGLDEIVKLQKPFVQKHNVTPGDFIAFAGAVALSNCPGAPQMNFFTGRAAPDGLVPEPFHTVDQIISRVNDAGQFDELELVWMLSAHSVAAVNDVDPTVQGLPFDSTPGIFDSQFFVETQLRGTAFPGSGGNQGEVESPLPGEFRIQSDHTIARDSRTACEWQSFVNNQSKLVSDFQFIFLALTQLGQDPNAMTDCSDVIPQSKPIPGNLPFSFFPAGKTINDVEQCAETPFPTLTTLPGPETSVQRIPPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). Probable problem with intron 4: too large and 4 aa are missing from the exon 5 (no AG at the correct position)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTTGCGGCTATCTCTCTTGCGCTCTCGCTCTCGGCTGCGAACGGTCTGCCTTTCGCACTTTATGCTCACTCTACGTGCTGAATGTTTGTTTGGTTATAGCGG
TCGCAGTGAAGGAGAAGCGCGCAACCTGCGCTAACGGCGTGACCGTTGGTGACGCGTCCTGTTGCGCCTGGTTCGATGTTTTGGATGACATCCAGGAGAATCTGTTCCACGGCGGGCAGT
GCGGCGCTGAAGCGCACGAGTCGATCCGTCT
GTAGGTCTTACAGTCGCAGTCATCCCGCGTATATGCCTCTGAGCTCCTGCACAGCGTCTTCCACGATTCTATCGCTATCTCTCCCGCTA
TGGAGGCCCAGGGCAAGTTCGG
GTAAGTGACGGCGTGCGTGATGGTACGCATTGCTCGGTCGTTGCTGAGCCTTGCTTGCAGAGGTGGTGGTGCAGACGGCTCCATCATGATCTTCGACG
ACATCGAGACGGCGTTCCATCCCAACATCGGTCTCGACGAGATTGTCAAGCTTCAGAAGCCGTTCGTCCAGAAGCACAACGTCACCCCTGGCGACTTTATCGCCTTCGCCGGGGCTGTCG
CACTCAGCAACTGCCCTGGTGCCCCTCAAATGAACTTCTTCACCGGTCGCGCTCCTG
GTATGTGCTTCATTCCAGTTCACCCCAAGGATTCCCAATAACATTGGGACTGTAGCTACATCA
GCAATTTCCTAGCGGCTCTTACAGCGCCTTTGGCACTTTCACAGACGCGCAAGCATTCAGACGGCGTTCTTATTCAGTTATGTACCGCTTTCAAAGCACGGCTTTCAGCTGTCAGACAGC
TCTACAGTGTGCATCAAACAGTGTAAAGTGGCCTACATTCTAGTTTCCCAGCATTAAGTACAGGCTCAAGTTCAGGTTCATCCAGGGGACGGATTGCACATGAATGAAGTTAAGCAGTGT
ATATTAATGCAGATACGATACAGTGTTGGTATATCTACAGGGGAACTATCCTAACTTATCAGGGGTCCTCAAGCCATGTGCACGGTGCTACCAGATGTGGAACCTCATAGGCAATGCATG
CCAACATGTATGAGGATGCAGCCCTGGACGTCAGAGTGTCAGTTACGCAACCACATATGATAGCATGCAACCAACTGCTGCTTGAACATGGACACGAGCATCGACACGCCCACGGCAGCG
CATGCAAATGTACTGGGTATTCCTGCGTACTTGGGCACAACGTTGATGCATTTGCCATACAACGAAGGGACAACGGCGGTGTCACGGCCCCGATGCACCCGGCACCATGGACAGCGAGGG
GCAGCTCACATAGGTGATGCATCTGGCCGGCATGCGAGGTGAATGGATCTTGCACGTTCGTCTTCACACATGTCGTTGCAATGGTTGTAGCGGAGGACAGAGGTGACGAGCGAGGGCAGC
AACAAACCAAGAATGCACACTCACCCTGTATGGACACCAGATCCTACGAGTGGTTTCCTGTGGCAGACGTGTGCAAGGTGGCGAAGCGCACAGAAGGACTTGCTGTCGTCCAGCACATCG
GCGGGCGCGAAGCGCAAGCAGAACGAGGGAGCTGGCCCCCGGCCGGCTTGGAAAGGTCATATGGGTACGTTGGTTGGTATCGAAAAATATGACAACTCACCGGTGTTCCACCAGGCTCTT
ACGCCCTGTACACTCGTCTATTTCTCCCAGTAGTCATCTTGGTTCACGGTTTGTGCATGTCTGTTCATTCCGTGCCATCGTGTCCTTGAGTGGTCGGTCTTCTGGATTGCTCCAGTAAGT
AAAGTCGTGTGATTCATAGCCTTCAAGACTGACCGAATGGAGAGGAGAGGTACTCGTGGGTCAACCCAGGAGCATAGGTGTCGACGAGAGGACAGGCAAGTCGAGAGTGTAAAGCGCCGG
CTGGACTTGGCACGGGCGCGTTCAACGAGGTCGAACCGTGGGAATACTGAAGCTTGAAGGAGCTCCCTTCACCGAAACGCATGCAGGCAGTCTGCCACGATGCCCCATCCTCTTACCTGG
CCCCTGTCGGTGGCATTGCTGTCGACATTCAAAAATGGAATTCGGTTTACACACAGTTGGCACGCATATCTTCAGGTTGCTCGGCGGAGGTGAGCACACCTCGGATGACAGCGTCGACGA
GCACGCAGATGCAAGAAGCGGTGAGCTTTCGTGGAATTGTTAGCCCGCATGGTATATAATGTAAGGTATGGTATTTGTTTGTGAAAGATGAGGTGTAAATACGCAATTTATATGCGAAAC
AAAGGGGGTAGGGCTCAGAGGTTAGTGTCCATGCCTGTTTGTGCATGTCTGTACTTGATGAAATGCTTTTACTTGATGGTGACATCCTACTTGACGACGAAAGCCGCTCTTTGCGTCTTT
GTGGCGCTTGTGACAGCAGCAAGTATGAAAGCGCTGCAAGACGGTCTGGGATATTGCTGATGTACCCAGCCAGCTCCAGATGGCCTTGTTCCCGAACCGTTCCGTAAGTGCATACTTCTA
GACAGACGTCACCGTACTTTCGCTCACATCTGCACCCAGACACTGTCGATCAAATCATCAGCCGTGTCAATGATGCCGGACAGTTCGATGAGCTCGAGCTTGTATGGATGCTTTCGGCGT
AAGTCTCGAGATTGTGTGTCAGTTCATCCTATCTGACTGCCTGGCAGGCACTCCGTCGCGGCAGTCAACGACGTCGATCCGACTGTCCAAGGTTTGCCCTTCGACTCGACGCCCGGAATC
TTCGACTCCCAGTTCTTCGTCGAGACTCAGCTCCGTGGCACCGCGTTTCCCGGGTCTGGCGGCAACCAGGGTGAGGTCGAGTCGCCTCTTCCCGGCGAGTTCCGCATCCAGTCGGACCAC
ACCATCGCCCGCGACTCGCGCACGGCGTGTGAATGGCAGTCCTTCGTCAACAACCAGTCGAAGCTCGTCTCTGACTTCCAGTTCATCTTCCTCGCCCTCACCCAGCTCGGCCAGGACCCG
AACGCGATGACCGACTGCTCGGATGTTATCCCACAGTCGAAGCCCATCCCCGGCAACCTTCCGTTCTCGTTCTTCCCCGCAGGCAAGACCATAAACGATGTTGAGCAGGCG
GTGCGTGAT
CTACATATTCGTAGGCGCGATGATCCTGATCTTTGCCTCGCAGTGCGCGGAGACCCCATTCCCCACACTCACGACCCTCCCTGGACCCGAGACCTCCGTCCAGCGCATGTGAGTACACAA
TCTAGGTTCAGCCCAGAAGCACGCACTGACAGCCTTTAGTCCGCCGCCCCCAGGTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTTGCGGCTATCTCTCTTGCGCTCTCGCTCTCGGCTGCGAACGCGGTCGCAGTGAAGGAGAAGCGCGCAACCTGCGCTAACGGCGTGACCGTTGGTGACGCG
TCCTGTTGCGCCTGGTTCGATGTTTTGGATGACATCCAGGAGAATCTGTTCCACGGCGGGCAGTGCGGCGCTGAAGCGCACGAGTCGATCCGTCT
CGTCTTCCACGATTCTATCGCTATC
TCTCCCGCTATGGAGGCCCAGGGCAAGTTCGG
AGGTGGTGGTGCAGACGGCTCCATCATGATCTTCGACGACATCGAGACGGCGTTCCATCCCAACATCGGTCTCGACGAGATTGTCAAG
CTTCAGAAGCCGTTCGTCCAGAAGCACAACGTCACCCCTGGCGACTTTATCGCCTTCGCCGGGGCTGTCGCACTCAGCAACTGCCCTGGTGCCCCTCAAATGAACTTCTTCACCGGTCGC
GCTCCTG
CTCCAGATGGCCTTGTTCCCGAACCGTTCCACACTGTCGATCAAATCATCAGCCGTGTCAATGATGCCGGACAGTTCGATGAGCTCGAGCTTGTATGGATGCTTTCGGCGCAC
TCCGTCGCGGCAGTCAACGACGTCGATCCGACTGTCCAAGGTTTGCCCTTCGACTCGACGCCCGGAATCTTCGACTCCCAGTTCTTCGTCGAGACTCAGCTCCGTGGCACCGCGTTTCCC
GGGTCTGGCGGCAACCAGGGTGAGGTCGAGTCGCCTCTTCCCGGCGAGTTCCGCATCCAGTCGGACCACACCATCGCCCGCGACTCGCGCACGGCGTGTGAATGGCAGTCCTTCGTCAAC
AACCAGTCGAAGCTCGTCTCTGACTTCCAGTTCATCTTCCTCGCCCTCACCCAGCTCGGCCAGGACCCGAACGCGATGACCGACTGCTCGGATGTTATCCCACAGTCGAAGCCCATCCCC
GGCAACCTTCCGTTCTCGTTCTTCCCCGCAGGCAAGACCATAAACGATGTTGAGCAGGCG
TGCGCGGAGACCCCATTCCCCACACTCACGACCCTCCCTGGACCCGAGACCTCCGTCCAG
CGCAT
TCCGCCGCCCCCAGGTGCTTAA

Retrieve as FASTA