Entry information : NhaeCIIAA
Entry ID 6837
Creation 2009-06-02 (Christophe Dunand)
Last sequence changes 2012-05-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2009-06-02 (Christophe Dunand)
Peroxidase information: NhaeCIIAA
Name NhaeCIIAA
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Nectria
Organism Nectria haematococca    [TaxId: 140110 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NhaeCIIAA
start..stop
S start..stop
FoCIIAA 639 0 1..486 1..503
GmoCIIAA 623 0 1..486 1..503
GzCIIAA01 588 0 1..486 1..532
CfioCIIAA01_MH18 439 1e-152 106..466 38..397
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1521690..1522892 1203 N° 2 1522942..1523202 261  
join(1521690..1522892,1522942..1523202)


exon

Literature and cross-references NhaeCIIAA
DNA ref. JGI genome:   sca_20_chr6_4_0 (1521690..1523202)
mRNA ref. JGI transcript:   4582
EST ref. GenBank:   GE228841.1 [3' end]
Protein sequence: NhaeCIIAA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   487 (466)
PWM (Da):   %s   52438.84 (50459.7)  
PI (pH):   %s   9.05 (9.05) Peptide Signal:   %s   cut: 22 range:22-487
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLSTIAVAALAAAPISEVAAHPGMGDTIREIKRIAARTTWGSSNSQNNKWGSSGSSSNGGSSWNSGGSSSSSWPSSGGSQSSGGSSWPSSGTSGSSQSGNGWSGDSFNPNQLLGDLRTLSDSSLTRVGSDIKKILQGSGNPESRDRYFGVPPMNTPRCKRDTCCVWKYISDELHTLFQGDSGRCSKWARYAVRMGFHDAGTWSTKTAAQGGGADGSIILAGELSRGENLGLQDMGKKYQEVYTKYHDNLGFDQVTYADLIQMGANIAAVTCPLGPRVRSFVGRQDTKKANPNNLLPNVNGNALYLINLFKDKTIGPDDLVALIGAHTTSQQNHVNTDRAGDPQDSTPGVWDVLFYKETIGTAPDRVYKLPSDVVLSKHPLTQPAFEAFAGGNGAQRAWNVDYARAYVRLSLLGVNNINDLTECTKVLPQPIDGYKHRDGSRFSKWLQSDDNSWDSKKISQEVENGYTISTPDNKIPTKRGPWRKWW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs (GE228842.1 and GE228841).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCTCTACCATCGCGGTAGCCGCTCTCGCGGCCGCCCCCATCTCCGAGGTTGCTGCTCACCCAGGAATGGGAGACACCATCCGTGAGATCAAGCGCATCGCTGCTCGTACTACA
TGGGGTAGCAGCAACAGTCAGAACAACAAATGGGGTAGTTCTGGTAGCTCGAGCAATGGCGGCAGCAGCTGGAACAGCGGAGGAAGCAGCAGCAGCAGCTGGCCAAGCTCTGGGGGAAGC
CAGAGCAGTGGAGGTAGCAGCTGGCCCAGCAGCGGCACCAGTGGTAGCAGCCAGTCTGGGAACGGCTGGTCCGGCGATAGCTTCAACCCCAACCAGCTCCTCGGCGACCTCCGCACTCTC
AGCGACAGCTCCCTCACCCGCGTCGGAAGCGACATCAAGAAGATTCTCCAGGGCAGCGGTAACCCCGAGAGCCGGGACCGCTACTTTGGAGTTCCCCCCATGAACACACCTCGCTGCAAG
CGAGACACTTGCTGTGTGTGGAAGTACATCTCTGATGAGCTGCACACACTGTTCCAGGGTGACTCTGGTCGCTGCAGCAAGTGGGCTCGTTATGCCGTTCGCATGGGTTTCCACGATGCT
GGTACATGGTCTACCAAGACCGCAGCTCAGGGCGGTGGTGCTGATGGTTCCATCATCCTGGCTGGTGAGCTTAGCCGTGGTGAGAACCTTGGTCTTCAGGATATGGGCAAGAAGTACCAG
GAGGTTTACACAAAGTATCACGACAACCTTGGCTTCGACCAGGTCACCTACGCCGACCTCATCCAGATGGGAGCCAACATCGCCGCCGTGACATGCCCCCTCGGCCCTCGCGTGCGCTCC
TTTGTCGGTCGCCAGGACACCAAGAAGGCTAACCCCAACAACCTCCTCCCCAACGTCAACGGAAACGCTCTCTACCTGATCAACCTCTTCAAGGACAAGACCATCGGCCCTGATGATCTC
GTCGCTCTTATCGGTGCCCACACCACCTCTCAGCAGAACCACGTCAACACCGACCGTGCTGGTGATCCTCAAGACAGCACCCCCGGTGTGTGGGATGTCCTCTTCTACAAGGAGACCATT
GGAACCGCCCCCGACCGTGTCTACAAGTTGCCGAGTGACGTTGTCCTCTCCAAGCACCCCCTGACCCAACCCGCTTTTGAAGCCTTTGCTGGTGGAAACGGAGCCCAACGTGCCTGGAAC
GTG
GTAAGTTCAACTCTTCCTTCTCCTAAAGAACATTCACTGACTTTTATAGGACTACGCCCGTGCTTACGTCCGCCTTAGCCTTCTGGGCGTCAACAACATCAACGACCTCACAGAGTG
CACCAAGGTCCTGCCACAGCCCATCGACGGCTACAAGCATCGCGACGGCAGCCGGTTCAGCAAGTGGCTCCAGAGCGACGACAACTCATGGGACTCGAAGAAGATTTCTCAAGAGGTTGA
GAACGGATACACAATCTCGACGCCCGACAACAAGATCCCTACTAAGCGTGGACCCTGGCGCAAGTGGTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCTCTACCATCGCGGTAGCCGCTCTCGCGGCCGCCCCCATCTCCGAGGTTGCTGCTCACCCAGGAATGGGAGACACCATCCGTGAGATCAAGCGCATCGCTGCTCGTACTACA
TGGGGTAGCAGCAACAGTCAGAACAACAAATGGGGTAGTTCTGGTAGCTCGAGCAATGGCGGCAGCAGCTGGAACAGCGGAGGAAGCAGCAGCAGCAGCTGGCCAAGCTCTGGGGGAAGC
CAGAGCAGTGGAGGTAGCAGCTGGCCCAGCAGCGGCACCAGTGGTAGCAGCCAGTCTGGGAACGGCTGGTCCGGCGATAGCTTCAACCCCAACCAGCTCCTCGGCGACCTCCGCACTCTC
AGCGACAGCTCCCTCACCCGCGTCGGAAGCGACATCAAGAAGATTCTCCAGGGCAGCGGTAACCCCGAGAGCCGGGACCGCTACTTTGGAGTTCCCCCCATGAACACACCTCGCTGCAAG
CGAGACACTTGCTGTGTGTGGAAGTACATCTCTGATGAGCTGCACACACTGTTCCAGGGTGACTCTGGTCGCTGCAGCAAGTGGGCTCGTTATGCCGTTCGCATGGGTTTCCACGATGCT
GGTACATGGTCTACCAAGACCGCAGCTCAGGGCGGTGGTGCTGATGGTTCCATCATCCTGGCTGGTGAGCTTAGCCGTGGTGAGAACCTTGGTCTTCAGGATATGGGCAAGAAGTACCAG
GAGGTTTACACAAAGTATCACGACAACCTTGGCTTCGACCAGGTCACCTACGCCGACCTCATCCAGATGGGAGCCAACATCGCCGCCGTGACATGCCCCCTCGGCCCTCGCGTGCGCTCC
TTTGTCGGTCGCCAGGACACCAAGAAGGCTAACCCCAACAACCTCCTCCCCAACGTCAACGGAAACGCTCTCTACCTGATCAACCTCTTCAAGGACAAGACCATCGGCCCTGATGATCTC
GTCGCTCTTATCGGTGCCCACACCACCTCTCAGCAGAACCACGTCAACACCGACCGTGCTGGTGATCCTCAAGACAGCACCCCCGGTGTGTGGGATGTCCTCTTCTACAAGGAGACCATT
GGAACCGCCCCCGACCGTGTCTACAAGTTGCCGAGTGACGTTGTCCTCTCCAAGCACCCCCTGACCCAACCCGCTTTTGAAGCCTTTGCTGGTGGAAACGGAGCCCAACGTGCCTGGAAC
GTG
GACTACGCCCGTGCTTACGTCCGCCTTAGCCTTCTGGGCGTCAACAACATCAACGACCTCACAGAGTGCACCAAGGTCCTGCCACAGCCCATCGACGGCTACAAGCATCGCGACGGC
AGCCGGTTCAGCAAGTGGCTCCAGAGCGACGACAACTCATGGGACTCGAAGAAGATTTCTCAAGAGGTTGAGAACGGATACACAATCTCGACGCCCGACAACAAGATCCCTACTAAGCGT
GGACCCTGGCGCAAGTGGTGGTGA

Retrieve as FASTA