Entry information : CnKat03_JEC21
Entry ID 6857
Creation 2009-06-22 (Christophe Dunand)
Last sequence changes 2012-05-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-22 (Achraf Jemmat)
Peroxidase information: CnKat03_JEC21
Name CnKat03_JEC21
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnKat03_JEC21
start..stop
S start..stop
CnKat03_H99 1433 0 1..714 1..714
CnKat01_grubiiH99 1281 0 1..714 1..714
CnKat01_JEC21 1265 0 1..714 1..714
CnKat01_B-3501A 1265 0 1..714 1..714
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1502046..1502067 22 N° 2 1501841..1501999 159 N° 3 1501654..1501787 134 N° 4 1501463..1501604 142
N° 5 1501375..1501406 32 N° 6 1500823..1501269 447 N° 7 1500348..1500764 417 N° 8 1499923..1500297 375
N° 9 1499457..1499873 417  
complement(join(1499457..1499873,1499923..1500297,1500348..1500764,1500823..1501 269,1501375..1501406,1501463..1501604,1501654..1501787,1501841..1501999,1502046. .1502067))


exon

Literature and cross-references CnKat03_JEC21
DNA ref. JGI genome:   NC_006670 (1502067..1499457)
mRNA ref. GenBank:   XM_566883 [Incorrect splicing]
Cluster/Prediction ref. UniGene:   Fne.3541
Protein sequence: CnKat03_JEC21
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   714
PWM (Da):   %s   79809.09  
PI (pH):   %s   6.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQMLNQAANMVTGDAKYRQMAEYTIDQDDKTPYTTYFGVKVSDTDNSLRAGARGPTLLEDFHNREKIQHFDHERIPERVVHARGAGAFGEFKLHTPLTGITTAVLTDTSKVVPAYVRFSTVAGSRGSADTVRDVRGFATRLYTDEGNWDIVGNNIPVFFIDGIKFPDVVHAIKPEPHNEIPQAQTAHDNAWDFMSLHKPALHMQQWITSDRAIPRSYRMMQGFGVHTFRLINEEGKSTFVKYHWIPHLGTHSLVWDEALKIAGQDPDFHRRDLWDAIEAGTYAKWDLGVQLIKEEDEHKFDFDLLDATKLIPDELVPVQKIGTLTLNRNPVDYFSEVEQVAFCTQHIVPGMDFTDDPLLAGRNFSYPDTQVSRLGINWKHIPVNRPVCPFMTTMREGQMSMFSKNNRTPYHPNRNENLPLTSPKEGGFKSYPAKVSGIKERVQAPKFNDHSSQATLFWNSMSDVEKKHIIDAYKFELSHCTDNLVIQNVINCINEIDHGLATAVHSGFPHLSLPEAKPNHGKRTEYLSQITGKNQIFTAAGRKIGIFLVPGYVYSQVAPLLAAFKAAGCMVKFVGPTLGPVEASDGQSFTTEFTFEGCRSTYFDALIFAGGPDNAFLSKLKVGRLIHAAREAYMHLKAVGAVGNATQWLVDTCLPGEFSPKVKTESSVVQENGVVFAPINPTLHSAQFAKQFLDGVANHRVWDREVSHIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 8 introns). DNA contains an extra "G" => bad intron for the junction exon 5/intron 5.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGATGTTAAACCAAGGTCAGGAGATTGAGTCTTTATGTAGATGGGGCTGATTCAAGTATAGCCGCCAATATGGTTACAGGCGACGCCAAATATCGTCAGATGGCTGAATACAC
CATCGACCAAGACGATAAGACCCCTTACACTACGTATTTCGGGGTCAAGGTGTCAGACACGGACAATTCCCTTCGAGCCGGCGCGAGGGGACCCACTCTACTGGAAG
GTAGGCTTCTAAT
CTTGTGCGCGGGCTTACGATAATCTAACACGTCTCATTAGACTTCCATAACCGTGAAAAGATTCAGCATTTTGATCACGAACGCATTCCAGAGCGTGTAGTTCACGCCCGGGGGGCGGGC
GCTTTCGGAGAATTCAAGCTTCACACCCCGCTGACTGGCATCACCACTGCGAAG
GTTTGTCAACTTACTCATCATTCTAGCCGATGTTAACTGGCTTTTTAAGGTTTTGACGGACACCAG
TAAGGTCGTACCAGCCTATGTTCGGTTCAGCACTGTTGCTGGTTCTCGGGGAAGCGCTGACACAGTGCGTGATGTCCGTGGATTTGCCACAAGACTTTATACGGACGAAGGAAACTGGGA
TATCG
GTAAGCTGTCTTTTTTTACGCCTTCGACAACTTATTACTGATCATATCTCACGTAGTCGGCAATAACATACCAGTGTTCTTCATTAATGGTAAGTCGTCATTACTCGGTGGCCAC
TCAATTTTTACTGATGATGGGAACAGCAAGTACCCTATTATAGTATCACAGGGCCCGCTGGCTGATTCATGCCCCTAGGATGGAATCAAGTTTCCGGATGTCGTCCATGCGATAAAACCC
GAACCTCACAATGAGATTCCTCAAGCCCAGACAGCTCACGACAATGCTTGGGACTTCATGTCTCTTCACAAGCCCGCTCTTCACATGCAGCAATGGATCACGTCTGATCGGGCGATTCCT
CGATCGTACCGTATGATGCAAGGGTTTGGCGTTCATACTTTCCGACTCATCAATGAGGAAGGTAAAAGTACCTTCGTTAAATATCATTGGATACCTCACCTTGGTACTCACTCTCTTGTG
TGGGATGAGGCCTTGAAGATTGCAGGGCAGGACCCTGATTTTCACCGAAGAGATCTTTGGGACGCAATCGAAGCTGGAACGTACGCCAAGTGGGATTTGGGTGTGCAGCTGATTAAAGAA
GAAGATGAGCACAAATTTGATTTTGATCTCCTTGATGCCACCAAG
GTATTTCTTACTTCTCTTTAACTCAAATGGGATTATCAAGCACTCACCACCTACATAGCTTATCCCTGACGAGCT
TGTGCCGGTTCAAAAAATCGGTACCCTCACACTCAACCGCAATCCTGTCGACTACTTTAGTGAAGTTGAGCAGGTTGCTTTCTGTACTCAGCACATCGTTCCCGGCATGGACTTTACCGA
TGATCCCCTTCTAGCTGGTCGAAACTTTTCCTATCCTGATACGCAGGTATCTCGCCTGGGCATCAATTGGAAACACATCCCTGTGAACAGGCCTGTTTGTCCCTTCATGACCACTATGCG
AGAGGGTCAAATGAGCATGTTTAGTAAGAACAATAGAACGCCTTATCATCCAAACAGGAATGAAAATCTCCCTCTTACATCGCCTAAGGAGGGAGGTTTTAAAAGCTATCCTGCAAAGGT
GTCTGGTATTAAAGAACGAGTTCAGGCCCCCAAATTCAAC
GTGTGTCTCTCAGTGTGTATTTGTCAGTCAGTATTGCTGATAAGGCGCAGGATCATTCCTCACAAGCCACTCTTTTCTGG
AACTCTATGAGTGATGTAGAAAAGAAGCATATCATTGACGCGTATAAATTTGAACTTTCACACTGTACTGACAATTTGGTCATACAAAATGTCATCAACTGTATCAATGAAATCGACCAT
GGACTTGCTACCGCAGTCCATTCCGGCTTCCCTCATCTCAGTCTGCCTGAAGCCAAACCCAACCATGGTAAGAGGACAGAATATCTGTCTCAGATTACGGGTAAAAATCAAATCTTCACT
GCTGCCGGGAGAAAAATTGGTATCTTCCTTGTGCCAGGGTACGTTTACTCGCAAGTCGCTCCCCTTCTTGCAGCTTTCAAAGCTGCTGGATGTATGGTAAAGTTT
GTGAGTGCCAATACA
GTACCTCACTGTGAATTTGTATTGATATCTCTAGGTCGGTCCGACTCTCGGTCCTGTTGAAGCTTCTGATGGCCAGTCATTCACTACGGAGTTTACTTTCGAAGGTTGCCGATCCACATA
TTTCGACGCTCTTATCTTCGCTGGCGGCCCTGATAATGCCTTTTTATCCAAGCTCAAAGTTGGTCGCCTCATTCACGCAGCTCGAGAGGCCTACATGCATCTGAAGGCGGTTGGGGCAGT
CGGCAATGCTACGCAATGGTTGGTTGACACATGTCTTCCTGGAGAATTTAGCCCCAAAGTCAAGACAGAATCCAGCGTGGTGCAGGAGAATGGTGTCGTGTTCGCACCAATCAACCCTAC
TCTCCACTCTGCACAATTTGCCAAACAATTTTTGGACGGTGTTGCCAATCATAGGGTTTGGGACAGAGAAGTCTCACACATCGCTGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGATGTTAAACCAAGCCGCCAATATGGTTACAGGCGACGCCAAATATCGTCAGATGGCTGAATACACCATCGACCAAGACGATAAGACCCCTTACACTACGTATTTCGGGGTC
AAGGTGTCAGACACGGACAATTCCCTTCGAGCCGGCGCGAGGGGACCCACTCTACTGGAAG
ACTTCCATAACCGTGAAAAGATTCAGCATTTTGATCACGAACGCATTCCAGAGCGTGTA
GTTCACGCCCGGGGGGCGGGCGCTTTCGGAGAATTCAAGCTTCACACCCCGCTGACTGGCATCACCACTGCGAAG
GTTTTGACGGACACCAGTAAGGTCGTACCAGCCTATGTTCGGTTC
AGCACTGTTGCTGGTTCTCGGGGAAGCGCTGACACAGTGCGTGATGTCCGTGGATTTGCCACAAGACTTTATACGGACGAAGGAAACTGGGATATCG
TCGGCAATAACATACCAGTGTTC
TTCATTAAT
GATGGAATCAAGTTTCCGGATGTCGTCCATGCGATAAAACCCGAACCTCACAATGAGATTCCTCAAGCCCAGACAGCTCACGACAATGCTTGGGACTTCATGTCTCTTCAC
AAGCCCGCTCTTCACATGCAGCAATGGATCACGTCTGATCGGGCGATTCCTCGATCGTACCGTATGATGCAAGGGTTTGGCGTTCATACTTTCCGACTCATCAATGAGGAAGGTAAAAGT
ACCTTCGTTAAATATCATTGGATACCTCACCTTGGTACTCACTCTCTTGTGTGGGATGAGGCCTTGAAGATTGCAGGGCAGGACCCTGATTTTCACCGAAGAGATCTTTGGGACGCAATC
GAAGCTGGAACGTACGCCAAGTGGGATTTGGGTGTGCAGCTGATTAAAGAAGAAGATGAGCACAAATTTGATTTTGATCTCCTTGATGCCACCAAG
CTTATCCCTGACGAGCTTGTGCCG
GTTCAAAAAATCGGTACCCTCACACTCAACCGCAATCCTGTCGACTACTTTAGTGAAGTTGAGCAGGTTGCTTTCTGTACTCAGCACATCGTTCCCGGCATGGACTTTACCGATGATCCC
CTTCTAGCTGGTCGAAACTTTTCCTATCCTGATACGCAGGTATCTCGCCTGGGCATCAATTGGAAACACATCCCTGTGAACAGGCCTGTTTGTCCCTTCATGACCACTATGCGAGAGGGT
CAAATGAGCATGTTTAGTAAGAACAATAGAACGCCTTATCATCCAAACAGGAATGAAAATCTCCCTCTTACATCGCCTAAGGAGGGAGGTTTTAAAAGCTATCCTGCAAAGGTGTCTGGT
ATTAAAGAACGAGTTCAGGCCCCCAAATTCAAC
GATCATTCCTCACAAGCCACTCTTTTCTGGAACTCTATGAGTGATGTAGAAAAGAAGCATATCATTGACGCGTATAAATTTGAACTT
TCACACTGTACTGACAATTTGGTCATACAAAATGTCATCAACTGTATCAATGAAATCGACCATGGACTTGCTACCGCAGTCCATTCCGGCTTCCCTCATCTCAGTCTGCCTGAAGCCAAA
CCCAACCATGGTAAGAGGACAGAATATCTGTCTCAGATTACGGGTAAAAATCAAATCTTCACTGCTGCCGGGAGAAAAATTGGTATCTTCCTTGTGCCAGGGTACGTTTACTCGCAAGTC
GCTCCCCTTCTTGCAGCTTTCAAAGCTGCTGGATGTATGGTAAAGTTT
GTCGGTCCGACTCTCGGTCCTGTTGAAGCTTCTGATGGCCAGTCATTCACTACGGAGTTTACTTTCGAAGGT
TGCCGATCCACATATTTCGACGCTCTTATCTTCGCTGGCGGCCCTGATAATGCCTTTTTATCCAAGCTCAAAGTTGGTCGCCTCATTCACGCAGCTCGAGAGGCCTACATGCATCTGAAG
GCGGTTGGGGCAGTCGGCAATGCTACGCAATGGTTGGTTGACACATGTCTTCCTGGAGAATTTAGCCCCAAAGTCAAGACAGAATCCAGCGTGGTGCAGGAGAATGGTGTCGTGTTCGCA
CCAATCAACCCTACTCTCCACTCTGCACAATTTGCCAAACAATTTTTGGACGGTGTTGCCAATCATAGGGTTTGGGACAGAGAAGTCTCACACATCGCTGCATAG

Retrieve as FASTA