Entry information : AvePrx111-1_H938
Entry ID 6863
Creation 2009-07-13 (ester Simonetti)
Last sequence changes 2012-05-09 (Bruno Savelli)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-09-30 (Bruno Savelli)
Peroxidase information: AvePrx111-1_H938
Name AvePrx111-1_H938
Class Class III peroxidase    [Orthogroup: Prx065]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Aegilops
Organism Aegilops ventricosa (Goatgrass) (Triticum ventricosum)    [TaxId: 116981 ]
Cellular localisation N/D
Tissue type Roots
Inducer Cyst nematode infection
Repressor N/D
Best BLASTp hits
Perox score E-value AvePrx111-1_H938
start..stop
S start..stop
TaPrx01-1B 638 0 1..316 1..316
AvePrx111-1E_H938 602 0 1..316 1..316
TaPrx01-1A 598 0 1..316 1..316
AvePrx111-1A_H938 597 0 1..316 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58..261 204 N° 2 389..580 192 N° 3 692..857 166 N° 4 946..1334 389
join(58..261,389..580,692..857,946..1334)


exon

Literature and cross-references AvePrx111-1_H938
Literature Simonetti,E., Veronico,P., Melillo,M.T., Delibes,A., Andres,M.F. and Lopez-Brana,I. Analysis of Class III Peroxidase Genes Expressed in Roots of Resistant and Susceptible Wheat Lines Infected by Heterodera avenae. Mol. Plant Microbe Interact. 22 (9), 1081-1092 (2009)
DNA ref. GenBank:   EU595573
Protein sequence: AvePrx111-1_H938
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (295)
PWM (Da):   %s   32962.08 (31058.1)  
PI (pH):   %s   5.63 (5.63) Peptide Signal:   %s   cut: 22 range:22-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASCLGLVVLVAMASAASAQLSSTFYDTSCPNALATIKAGVTAALNTETRMGASLVRLHFHDCFVDGCDGSVLLADTGSFIGEQGAAPNNNSIRGMNVIDNIKTQVEAVCKQTVSCADILAVAARDSVVALGGPTWTVLLGRRDSTTASKTNAENDLPPPTFDLQNLTTLFGNKQLSMTDMVALSGAHTIGQSQCRFFRDRIYNETNINTTFATSLRANCPQSGGDSSLAPLDTATPNAFDNSYYTNLMSQKGLLHSDQVLFNGGGADNTVMSFATSAATFNSAFTTAMINMGNIAPKTGTQGQIRLVCSKVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Triticum aestivum/Aegilops ventricosa introgression line, genotype: "H-93-8"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCTCTTGCCTTGGCTTAGTAGTGCTCGTGGCAATGGCCTCCGCGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGGCCACCATCAAG
GCCGGCGTGACGGCCGCCCTGAACACCGAAACCCGCATGGGGGCGTCGCTGGTCCGGCTGCACTTCCACGACTGCTTCGTCGAT
GCAAGTCCCATAACCTTACTCTTTTTTTTTTGACAG
CAAGTCCCATAACCTTACTCAGTTGGCAGTATTAGACAGTCACGCTGTAAAAGAAACTGTCAAATGATAGTGTTTCTGAAATTCTTTCCAGGGATGTGACGGGTCTGTTCTGTTGGCGGA
CACGGGGAGCTTCATCGGCGAGCAGGGCGCAGCCCCGAACAACAATTCCATTCGTGGCATGAACGTCATCGACAACATCAAGACCCAGGTGGAGGCCGTGTGCAAGCAGACCGTCTCCTG
CGCCGACATCCTCGCCGTCGCCGCCCGTGACTCCGTCGTCGCG
GTAAGCTCGACAATTACTACAGTAGCTCTGATGCATGTATTGATGAAGCACATGCCAGTAGTTCTAGTATCTGAACT
GTGGTTTGGAACTAATTCTGCGCATACCAAGCAGCTGGGTGGGCCGACATGGACAGTTCTTCTGGGGAGGAGGGACTCCACCACTGCAAGCAAGACCAACGCGGAAAATGACCTGCCACC
TCCTACCTTCGACCTCCAAAACCTCACCACCTTGTTCGGCAACAAGCAGCTCAGCATGACAGACATGGTTGCCCTCTCAG
GTACACCCCGCTAATATCTAGCTCAAACTTCACCACAACG
ACTGGCAAGAGATATTCTGACACGGGTGTGCTCTCGATCTATCTGCAGGCGCCCACACGATCGGGCAATCGCAGTGCCGGTTTTTCAGGGACAGGATCTACAACGAGACCAACATCAACA
CCACCTTCGCGACATCTCTCAGGGCCAACTGCCCCCAGTCCGGCGGCGACAGCAGCCTGGCGCCGCTGGACACAGCGACGCCCAATGCGTTCGACAACTCCTACTACACCAACCTCATGT
CCCAGAAGGGGCTGCTTCACTCGGACCAGGTGCTGTTCAATGGCGGCGGCGCCGACAACACGGTCATGAGCTTCGCGACCAGCGCGGCCACGTTCAACAGCGCCTTCACGACGGCCATGA
TAAACATGGGAAACATCGCGCCAAAGACGGGGACGCAGGGGCAGATCAGGCTCGTCTGCTCCAAGGTCAACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCTCTTGCCTTGGCTTAGTAGTGCTCGTGGCAATGGCCTCCGCGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGGCCACCATCAAG
GCCGGCGTGACGGCCGCCCTGAACACCGAAACCCGCATGGGGGCGTCGCTGGTCCGGCTGCACTTCCACGACTGCTTCGTCGAT
GGATGTGACGGGTCTGTTCTGTTGGCGGACACGGGG
AGCTTCATCGGCGAGCAGGGCGCAGCCCCGAACAACAATTCCATTCGTGGCATGAACGTCATCGACAACATCAAGACCCAGGTGGAGGCCGTGTGCAAGCAGACCGTCTCCTGCGCCGAC
ATCCTCGCCGTCGCCGCCCGTGACTCCGTCGTCGCG
CTGGGTGGGCCGACATGGACAGTTCTTCTGGGGAGGAGGGACTCCACCACTGCAAGCAAGACCAACGCGGAAAATGACCTGCCA
CCTCCTACCTTCGACCTCCAAAACCTCACCACCTTGTTCGGCAACAAGCAGCTCAGCATGACAGACATGGTTGCCCTCTCAG
GCGCCCACACGATCGGGCAATCGCAGTGCCGGTTTTTC
AGGGACAGGATCTACAACGAGACCAACATCAACACCACCTTCGCGACATCTCTCAGGGCCAACTGCCCCCAGTCCGGCGGCGACAGCAGCCTGGCGCCGCTGGACACAGCGACGCCCAAT
GCGTTCGACAACTCCTACTACACCAACCTCATGTCCCAGAAGGGGCTGCTTCACTCGGACCAGGTGCTGTTCAATGGCGGCGGCGCCGACAACACGGTCATGAGCTTCGCGACCAGCGCG
GCCACGTTCAACAGCGCCTTCACGACGGCCATGATAAACATGGGAAACATCGCGCCAAAGACGGGGACGCAGGGGCAGATCAGGCTCGTCTGCTCCAAGGTCAACTCGTAA

Retrieve as FASTA