Entry information : BrPrx15-1Ac_other ( Bra039920 / Brara.G00209)
Entry ID 6898
Creation 2009-08-04 (Christophe Dunand)
Last sequence changes 2016-02-09 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-09 (Achraf Jemmat)
Peroxidase information: BrPrx15-1Ac_other ( Bra039920 / Brara.G00209)
Name (synonym) BrPrx15-1Ac_other ( Bra039920 / Brara.G00209)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Brassica
Organism Brassica rapa    [TaxId: 3711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BrPrx15-1Ac_other
start..stop
S start..stop
TsPrx15 626 0 1..336 1..336
AruPrx15 614 0 1..336 1..335
AtPrx15 612 0 1..335 1..336
AhalPrx05 609 0 1..335 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 161..400 240 N° 2 483..674 192 N° 3 750..915 166 N° 4 1017..1429 413
join(161..400,483..674,750..915,1017..1429)


exon

Literature and cross-references BrPrx15-1Ac_other ( Bra039920 / Brara.G00209)
Literature Wang,X. et al., The Brassica rapa Genome Sequencing Project Consortium. The genome of the mesopolyploid crop species Brassica rapa. Nat. Genet. 43 (10), 1035-1039 (2011)
Protein ref. GenBank:   XP_009102275.1
DNA ref. GenBank:   NC_024801.1 (1634698..1635966) Phytozome 12:   A07 (1916047..1917521)
mRNA ref. GenBank:   XM_009104027.1
EST ref. GenBank:   EX075181.1 [5' end]
Cluster/Prediction ref. Phytozome Gene 12:   30633942
Protein sequence: BrPrx15-1Ac_other ( Bra039920 / Brara.G00209)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (314)
PWM (Da):   %s   36401.63 (33940.4)  
PI (pH):   %s   4.83 (4.74) Peptide Signal:   %s   cut: 23 range:23-336
Sequence 378
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATTRTFLVLFSLACSLSLCICDDESNYGGGEGNLFPGFYRSSCPRAEEIVRSVVAQAVAREARMAASLMRLHFHDCFVQGCDGSLLLDSSGSIITEKGSNPNSNSARGFDVVDQIKAALENECPGTVSCADLLTLAARDSSVLTGGPSWMVPLGRRDSRSASLSGSNNNIPAPNNTFNTILSRFTNQGLDLTDLVALSGSHTIGFSRCTSFRQRLYNQSGNGSPDITLEQSYATNLRQRCPPSGGDQNLSELDINSAGKFDNSYFKNLIENMGLLNSDQVLFSSKEESSELVKKYAEDQEEFFEQFAESMIKMGNLSPLTGSSGEIRKNCRKINS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns), 2 ESTs (EX076184.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACAACAAGAACCTTTCTAGTTCTTTTCTCTCTTGCTTGTTCTCTTAGTCTCTGCATCTGCGACGACGAGAGTAACTATGGCGGTGGTGAAGGGAATCTTTTCCCAGGTTTCTATA
GAAGCTCATGCCCTAGAGCCGAGGAGATCGTGAGGTCAGTTGTAGCACAAGCTGTTGCAAGAGAGGCTCGTATGGCTGCTTCTCTCATGAGGCTTCATTTCCACGACTGTTTTGTTCAG
G
TACTCAATAGTTTCTTTTAGAGAGTTACTTGCTCAACAAGCTAACGATTAATGTAGAAAATTATCATTGTATCTGTTGTAGGGCTGTGATGGCTCGTTGCTTCTAGACAGCAGTGGGAGT
ATAATTACTGAGAAAGGCTCTAACCCTAACAGTAACTCGGCTCGCGGGTTTGATGTTGTTGACCAGATCAAAGCTGCATTGGAGAATGAATGCCCTGGAACTGTTTCTTGTGCTGACTTG
TTAACCCTAGCTGCTAGGGACTCCTCTGTTCTT
GTAAGTCGGTTTCTTATACTCACTTTACTTCTTTCTTAGGCTGTCAGGATCTAATTTAGTTTAGATTTGGCGCAGACCGGTGGACCA
AGCTGGATGGTTCCTTTGGGAAGAAGAGATTCGAGAAGTGCAAGCTTGAGTGGCTCAAACAACAACATTCCTGCACCCAACAACACTTTCAACACAATTCTCTCGAGGTTTACTAACCAA
GGTCTTGATCTCACCGACCTTGTTGCCCTCTCTG
GTAAGCTTACTTTACACACAAGGAAAAGACATGGTCATGTTCAATTTACGTGCTTCTCAAGTTAACATTAAAACCTAAAGCATTTA
TTACTTATTTTTCAGGGAGTCACACCATCGGATTCTCAAGATGCACGAGTTTCAGACAAAGACTTTACAACCAGTCTGGAAATGGAAGTCCCGACATAACCTTAGAGCAGTCCTATGCTA
CTAACTTGCGCCAGAGGTGTCCGCCATCAGGTGGAGACCAAAACCTGTCGGAGCTTGACATCAACAGTGCCGGAAAGTTTGATAACAGCTACTTCAAGAACTTGATCGAGAACATGGGAC
TTTTGAATTCTGACCAGGTCTTATTCTCTAGCAAAGAGGAATCTAGCGAGCTTGTGAAGAAATATGCAGAGGATCAGGAAGAGTTCTTTGAGCAGTTCGCGGAATCGATGATCAAGATGG
GGAATCTCTCTCCCTTGACAGGTTCGAGTGGTGAGATCAGGAAGAACTGCAGGAAGATTAACTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACAACAAGAACCTTTCTAGTTCTTTTCTCTCTTGCTTGTTCTCTTAGTCTCTGCATCTGCGACGACGAGAGTAACTATGGCGGTGGTGAAGGGAATCTTTTCCCAGGTTTCTATA
GAAGCTCATGCCCTAGAGCCGAGGAGATCGTGAGGTCAGTTGTAGCACAAGCTGTTGCAAGAGAGGCTCGTATGGCTGCTTCTCTCATGAGGCTTCATTTCCACGACTGTTTTGTTCAG
G
GCTGTGATGGCTCGTTGCTTCTAGACAGCAGTGGGAGTATAATTACTGAGAAAGGCTCTAACCCTAACAGTAACTCGGCTCGCGGGTTTGATGTTGTTGACCAGATCAAAGCTGCATTGG
AGAATGAATGCCCTGGAACTGTTTCTTGTGCTGACTTGTTAACCCTAGCTGCTAGGGACTCCTCTGTTCTT
ACCGGTGGACCAAGCTGGATGGTTCCTTTGGGAAGAAGAGATTCGAGAA
GTGCAAGCTTGAGTGGCTCAAACAACAACATTCCTGCACCCAACAACACTTTCAACACAATTCTCTCGAGGTTTACTAACCAAGGTCTTGATCTCACCGACCTTGTTGCCCTCTCTG
GGA
GTCACACCATCGGATTCTCAAGATGCACGAGTTTCAGACAAAGACTTTACAACCAGTCTGGAAATGGAAGTCCCGACATAACCTTAGAGCAGTCCTATGCTACTAACTTGCGCCAGAGGT
GTCCGCCATCAGGTGGAGACCAAAACCTGTCGGAGCTTGACATCAACAGTGCCGGAAAGTTTGATAACAGCTACTTCAAGAACTTGATCGAGAACATGGGACTTTTGAATTCTGACCAGG
TCTTATTCTCTAGCAAAGAGGAATCTAGCGAGCTTGTGAAGAAATATGCAGAGGATCAGGAAGAGTTCTTTGAGCAGTTCGCGGAATCGATGATCAAGATGGGGAATCTCTCTCCCTTGA
CAGGTTCGAGTGGTGAGATCAGGAAGAACTGCAGGAAGATTAACTCTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCACAAAGTC ATCTCACTTA ATCTTCTTGC TCAAGTTGAA ATAGACGATG GCAACAACAA GAACCTTTCT AGTTCTTTTC TCTCTTGCTT GTTCTCTTAG TCTCTGCATC TGCGACGACG  AGAGTAACTA TGGCGGTGGT GAAGGGAATC TTTTCCCAGG TTTCTATAGA AGCTCATGCC CTAGAGCCGA GGAGATCGTG AGGTCAGTTG TAGCACAAGC TGTTGCAAGA GAGGCTCGTA  TGGCTGCTTC TCTCATGAGG CTTCATTTCC ACGACTGTTT TGTTCAGGGC TGTGATGGCT CGTTGCTTCT AGACAGCAGT GGGAGTATAA TTACTGAGAA AGGCTCTAAC CCTAACAGTA  ACTCGGCTCG CGGGTTTGAT GTTGTTGACC AGATCAAAGC TGCATTGGAG AATGAATGCC CTGGAACTGT TTCTTGTGCT GACTTGTTAA CCCTAGCTGC TAGGGACTCC TCTGTTCTTA  CCGGTGGACC AAGCTGGATG GTTCCTTTGG GAAGAAGAGA TTCGAGAAGT GCAAGCTTGA GTGGCTCAAA CAACAACATT CCTGCACCCA ACAACACTTT CAACACAATT CTCTCGAGGT  TTACTAACCA AGGTCTTGAT CTCACCGACC TTGTTGCCCT CTCTGGGAGT CACACCATCG GATTCTCAAG ATGCACGAGT TTCAGACAAA GACTTTACAA CCAGTCTGGA AATGGAAGTC  CCGACATAAC CTTAGAGCAG TCCTATGCTA CTAACTTGCG CCAGAGGTGT CCGCCATCAG GTGGAGACCA AAACCTGTCG GAGCTTGACA TCAACAGTGC CGGAAAGTTT GATAACAGCT  ACTTCAAGAA CTTGATCGAG AACATGGGAC TTTTGAATTC TGACCAGGTC TTATTCTCTA GCAAAGAGGA ATCTAGCGAG CTTGTGAAGA AATATGCAGA GGATCAGGAA GAGTTCTTTG  AGCAGTTCGC GGAATCGATG ATCAAGATGG GGAATCTCTC TCCCTTGACA GGTTCGAGTG GTGAGATCAG GAAGAACTGC AGGAAGATTA ACTCTTGATT TTGTGTGCGA TATGGAATAG  GAGAAAAACA AATGAAAGAT GTTTTCGGGA TTTGGGTTTG TGTTTGTGTT TTTGGTGTCC TTTTGTGTGT GTTTACTATT TGAAAGTTGA ATGATGAAAC CTTTATAATT AAATAGTGTT 
ATTTATATAA GCTCGAA 

Retrieve as FASTA