Entry information : SmPrx01-2_114 (SmPrx01b_114)
Entry ID 6951
Creation 2009-12-01 (Christophe Dunand)
Last sequence changes 2009-12-01 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx01-2_114 (SmPrx01b_114)
Name (synonym) SmPrx01-2_114 (SmPrx01b_114)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx01-2_114
start..stop
S start..stop
SmPrx01-1_122 684 0 1..341 1..341
SmPrx09-1_40 450 7e-160 19..323 28..331
SmPrx09-2_89 450 7e-160 19..323 28..331
GbPrx43 327 4e-112 6..321 12..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 340090..340287 198 N° 2 340345..340539 195 N° 3 340606..340771 166 N° 4 340844..341310 467
join(340090..340287,340345..340539,340606..340771,340844..341310)


exon

Literature and cross-references SmPrx01-2_114 (SmPrx01b_114)
DNA ref. Phytozome 12:   scaffold_114 (340090..341310)
mRNA ref. JGI transcript:   132915 [Incorrect prediction]
EST ref. GenBank:   FE466363.1 [5' end]   FE466362.1 [3' end]
Protein sequence: SmPrx01-2_114 (SmPrx01b_114)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (320)
PWM (Da):   %s   37442 (35144.7)  
PI (pH):   %s   7.94 (7.31) Peptide Signal:   %s   cut: 22 range:22-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARRMLVVSLLAILCLADARTEEFFYNRTCPNAETIVRDVVTSHFRNNRTIPAALLRLFFHDCFVEGCDGSLLLDASADGAVIEKQALPNINSARGFEVIDDAKARLESTCPGVVSCADILALAARDSVVLTGAPFFVMPTGRFDGRISNRTLAEAALPSPFDSATRLKDSFSRQNLTVQDLVHLSGAHTIGQSQCQFFSPRLYNFSNTGVPDPTLNATYRAELQQACPRNANATNRVALDRGSEFVVDNSYYRNLVAGRGLLRSDQELTLDSETESIVRSFAGDENRFQLRFRRSLLKMGELRIKTSANGEIRRNCRRVNPRSTIIVTTTNGDDAAASTI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 4 ESTs. Incorrect prediction from JGI (short PS is missing). Contig also contains 2 other Perox.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAAGAATGCTTGTGGTATCGTTGCTTGCAATCCTATGTCTTGCAGATGCGCGCACCGAGGAGTTCTTCTACAACAGGACTTGCCCGAATGCGGAGACGATTGTCCGAGACGTG
GTCACCTCGCATTTCCGGAACAACCGGACCATCCCGGCGGCACTGCTGCGACTCTTTTTCCACGACTGCTTCGTCGAG
GTATACAAGCTCTAGGTGGTCAGCTCGACTCGCTAGGATTGA
TTTGGAAATTGGCAGGGGTGCGATGGATCGCTGCTGCTGGATGCGTCCGCCGATGGCGCTGTGATCGAGAAGCAGGCGCTGCCAAACATCAACTCGGCCCGGGGCTTCGAGGTGATTGAC
GATGCAAAGGCGCGGCTCGAGAGCACTTGCCCCGGCGTCGTCTCGTGCGCGGACATCCTCGCGCTGGCAGCAAGGGACTCGGTTGTCCTC
GTAAGTTTGGTTTGATCCTTGATGGCGATA
TCATTTATCTCACTATGATCACTCTTGTTTCTCTAGACCGGAGCACCCTTCTTTGTCATGCCCACCGGCCGCTTTGATGGTCGGATCTCAAACCGGACACTCGCCGAGGCCGCTCTGCCG
TCGCCATTCGACAGTGCCACCAGGCTCAAGGACTCATTCTCTCGACAGAACCTCACAGTCCAGGACTTGGTCCACCTCTCGG
GTACGTAAAACTAATATATCGTATTACATAGTGATATA
TTAGATCTCGCCAACCCAACTCCAACTTCCACAGGGGCACACACAATTGGCCAGTCGCAATGTCAGTTCTTCTCGCCCCGCCTCTACAACTTTAGCAACACTGGAGTCCCGGATCCAACC
TTGAATGCCACGTACCGGGCTGAGCTCCAGCAGGCATGCCCGCGCAACGCCAATGCCACCAACAGGGTGGCGCTGGACCGAGGCTCCGAGTTCGTGGTGGACAACAGCTATTATCGCAAC
CTGGTGGCGGGGAGGGGGCTGCTGCGATCCGACCAGGAGCTCACCCTTGACTCGGAGACGGAGAGCATCGTGCGGTCGTTTGCCGGGGACGAGAACCGATTCCAGCTGCGCTTCCGGAGG
TCTCTGCTCAAGATGGGTGAGCTGAGGATCAAGACGTCGGCCAACGGGGAAATTCGGAGGAACTGTAGGCGCGTGAACCCCAGAAGCACCATCATTGTCACCACCACGAATGGCGATGAT
GCTGCTGCCTCCACCATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAAGAATGCTTGTGGTATCGTTGCTTGCAATCCTATGTCTTGCAGATGCGCGCACCGAGGAGTTCTTCTACAACAGGACTTGCCCGAATGCGGAGACGATTGTCCGAGACGTG
GTCACCTCGCATTTCCGGAACAACCGGACCATCCCGGCGGCACTGCTGCGACTCTTTTTCCACGACTGCTTCGTCGAG
GGGTGCGATGGATCGCTGCTGCTGGATGCGTCCGCCGATGGC
GCTGTGATCGAGAAGCAGGCGCTGCCAAACATCAACTCGGCCCGGGGCTTCGAGGTGATTGACGATGCAAAGGCGCGGCTCGAGAGCACTTGCCCCGGCGTCGTCTCGTGCGCGGACATC
CTCGCGCTGGCAGCAAGGGACTCGGTTGTCCTC
ACCGGAGCACCCTTCTTTGTCATGCCCACCGGCCGCTTTGATGGTCGGATCTCAAACCGGACACTCGCCGAGGCCGCTCTGCCGTCG
CCATTCGACAGTGCCACCAGGCTCAAGGACTCATTCTCTCGACAGAACCTCACAGTCCAGGACTTGGTCCACCTCTCGG
GGGCACACACAATTGGCCAGTCGCAATGTCAGTTCTTCTCG
CCCCGCCTCTACAACTTTAGCAACACTGGAGTCCCGGATCCAACCTTGAATGCCACGTACCGGGCTGAGCTCCAGCAGGCATGCCCGCGCAACGCCAATGCCACCAACAGGGTGGCGCTG
GACCGAGGCTCCGAGTTCGTGGTGGACAACAGCTATTATCGCAACCTGGTGGCGGGGAGGGGGCTGCTGCGATCCGACCAGGAGCTCACCCTTGACTCGGAGACGGAGAGCATCGTGCGG
TCGTTTGCCGGGGACGAGAACCGATTCCAGCTGCGCTTCCGGAGGTCTCTGCTCAAGATGGGTGAGCTGAGGATCAAGACGTCGGCCAACGGGGAAATTCGGAGGAACTGTAGGCGCGTG
AACCCCAGAAGCACCATCATTGTCACCACCACGAATGGCGATGATGCTGCTGCCTCCACCATCTAG

Retrieve as FASTA