Entry information : SmPrx02-2_114 (SmPrx02b_114)
Entry ID 6952
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2009-08-18 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx02-2_114 (SmPrx02b_114)
Name (synonym) SmPrx02-2_114 (SmPrx02b_114)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx02-2_114
start..stop
S start..stop
SmPrx02-1_122 707 0 1..354 1..354
SmPrx22-1_79 363 6e-126 6..327 20..340
SmPrx22-2_67 358 6e-124 29..327 40..337
SmPrx01-1_122 325 7e-111 8..331 5..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 342472..342684 213 N° 2 342226..342420 195 N° 3 341998..342163 166 N° 4 341455..341945 491
complement(join(341455..341945,341998..342163,342226..342420,342472..342684))


exon

Literature and cross-references SmPrx02-2_114 (SmPrx02b_114)
DNA ref. Phytozome 12:   scaffold_114 (342684..341455)
mRNA ref. JGI transcript:   429447 [Fragment]
Protein sequence: SmPrx02-2_114 (SmPrx02b_114)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (330)
PWM (Da):   %s   37793.41 (35250.1)  
PI (pH):   %s   8.74 (8.92) Peptide Signal:   %s   cut: 25 range:25-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPWFSAAMIVVILTASLELGVVQSSTVVGYYSHSCPAAEKIVSQVVAEQFATRPLVAAGILRLYFHDCFVEGCDGSILLDASPDGTPPEKRSLANNNTATGFELVDAAKRRIEAVCPGTVSCADILALAARDSVAISGGPRWEEPTGRYDGRVSLASNADGSIPGPSFNLTRLIHSFANKTLDSRDLVTLSGGHTIGRSHCANFQIRLYNSSGTGLPDPALNPAYATALRRICPNTSPARRATLSLDRGSEIPFDNSYFVQLLAGNGLLRSDEELLLDGSMRGLISAFAANQRLFFREFAKAMVKLGGIGVKDSIQGEIRLHCRRVNRRNSGSSPRVPTPPPPIMRSRAPPPPY

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Contig also contains Prx01a and 03a.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTGGTTCTCGGCAGCGATGATAGTTGTGATACTGACAGCAAGTTTGGAGCTTGGAGTGGTCCAGAGCAGCACCGTGGTGGGATACTACTCACACTCTTGCCCGGCGGCCGAGAAG
ATTGTGAGCCAGGTTGTGGCGGAGCAATTCGCAACCAGGCCGCTCGTCGCTGCCGGTATACTTCGACTCTACTTCCACGACTGCTTCGTAGAG
GTAGCGCGCGAAAGTGGTAATCCTGTT
CTTACATTTCTGTGTCTATCAAAGGGATGCGATGGATCCATTCTTCTCGACGCATCGCCCGACGGCACACCGCCTGAGAAGCGGAGCCTGGCAAACAATAACACAGCCACTGGATTCGAG
CTCGTCGACGCGGCCAAGAGACGCATCGAGGCGGTCTGTCCGGGCACCGTGTCGTGCGCAGACATTCTCGCTCTGGCCGCCAGAGACTCCGTCGCAATA
GTAAGTGCCTGGATCATCATG
GTCGAATAAGCTCTTCACATGATTGTTGCTCGGTGATATAGTCGGGGGGACCTCGCTGGGAGGAGCCAACTGGACGCTACGATGGAAGGGTGTCTCTGGCGTCCAATGCTGATGGCAGCA
TTCCCGGGCCTTCCTTCAACCTCACTCGCCTCATCCATTCCTTCGCAAACAAGACACTCGATTCCAGGGACCTTGTTACACTCTCGG
GTACGATCAGATGCATGAAATAACATAAACCAT
GTCGAAACAATCAATGCAGGAGGCCACACGATCGGTCGATCCCATTGCGCCAACTTCCAAATCCGTCTCTACAATTCCTCTGGCACCGGGCTACCGGACCCGGCGTTGAATCCCGCCTAC
GCCACTGCTTTGAGACGGATCTGCCCAAACACTTCTCCGGCCAGGCGCGCGACACTGTCTCTAGACAGAGGCAGCGAGATCCCCTTCGACAACTCCTACTTTGTGCAGCTCCTGGCTGGC
AACGGGCTTCTCAGGAGCGACGAGGAGCTGCTGCTGGATGGATCCATGCGGGGCCTCATCAGTGCTTTCGCCGCAAACCAGCGACTATTTTTCCGCGAGTTCGCCAAGGCTATGGTGAAG
TTGGGAGGGATTGGTGTCAAGGATTCCATCCAGGGCGAGATCAGGCTGCATTGCCGGCGCGTGAATAGAAGAAACTCCGGATCATCCCCGCGAGTTCCCACGCCACCACCTCCAATAATG
CGCTCCAGAGCTCCGCCACCTCCGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTGGTTCTCGGCAGCGATGATAGTTGTGATACTGACAGCAAGTTTGGAGCTTGGAGTGGTCCAGAGCAGCACCGTGGTGGGATACTACTCACACTCTTGCCCGGCGGCCGAGAAG
ATTGTGAGCCAGGTTGTGGCGGAGCAATTCGCAACCAGGCCGCTCGTCGCTGCCGGTATACTTCGACTCTACTTCCACGACTGCTTCGTAGAG
GGATGCGATGGATCCATTCTTCTCGAC
GCATCGCCCGACGGCACACCGCCTGAGAAGCGGAGCCTGGCAAACAATAACACAGCCACTGGATTCGAGCTCGTCGACGCGGCCAAGAGACGCATCGAGGCGGTCTGTCCGGGCACCGTG
TCGTGCGCAGACATTCTCGCTCTGGCCGCCAGAGACTCCGTCGCAATA
TCGGGGGGACCTCGCTGGGAGGAGCCAACTGGACGCTACGATGGAAGGGTGTCTCTGGCGTCCAATGCTGAT
GGCAGCATTCCCGGGCCTTCCTTCAACCTCACTCGCCTCATCCATTCCTTCGCAAACAAGACACTCGATTCCAGGGACCTTGTTACACTCTCGG
GAGGCCACACGATCGGTCGATCCCAT
TGCGCCAACTTCCAAATCCGTCTCTACAATTCCTCTGGCACCGGGCTACCGGACCCGGCGTTGAATCCCGCCTACGCCACTGCTTTGAGACGGATCTGCCCAAACACTTCTCCGGCCAGG
CGCGCGACACTGTCTCTAGACAGAGGCAGCGAGATCCCCTTCGACAACTCCTACTTTGTGCAGCTCCTGGCTGGCAACGGGCTTCTCAGGAGCGACGAGGAGCTGCTGCTGGATGGATCC
ATGCGGGGCCTCATCAGTGCTTTCGCCGCAAACCAGCGACTATTTTTCCGCGAGTTCGCCAAGGCTATGGTGAAGTTGGGAGGGATTGGTGTCAAGGATTCCATCCAGGGCGAGATCAGG
CTGCATTGCCGGCGCGTGAATAGAAGAAACTCCGGATCATCCCCGCGAGTTCCCACGCCACCACCTCCAATAATGCGCTCCAGAGCTCCGCCACCTCCGTACTAG

Retrieve as FASTA