Entry information : SmPrx03-2_114 (SmPrx03b_114)
Entry ID 6954
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2009-08-18 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx03-2_114 (SmPrx03b_114)
Name (synonym) SmPrx03-2_114 (SmPrx03b_114)
Class Class III peroxidase    [Orthogroup: Prx277]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx03-2_114
start..stop
S start..stop
SmPrx03-1_122 643 0 1..317 1..317
SmPrx35-1_84 323 8e-111 20..316 27..328
SmPrx35-2_170 323 1e-110 20..316 27..328
SmPrx10-2_25 314 4e-107 19..316 22..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 345434..345631 198 N° 2 345699..345887 189 N° 3 345981..346146 166 N° 4 346201..346601 401
join(345434..345631,345699..345887,345981..346146,346201..346601)


exon

Literature and cross-references SmPrx03-2_114 (SmPrx03b_114)
DNA ref. Phytozome 12:   scaffold_114 (345434..346601)
mRNA ref. JGI transcript:   132865
EST ref. GenBank:   FE433553.1 [3' end]
Protein sequence: SmPrx03-2_114 (SmPrx03b_114)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (298)
PWM (Da):   %s   33470.68 (31402.5)  
PI (pH):   %s   5.28 (5.65) Peptide Signal:   %s   cut: 20 range:20-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLEPLFVLVLQLSAVCIQAQLLVGFYDSSCPRAESIVQQSVMMAIQSNRPLASRLVRLFFHDCFVQGCDASILLDSTPNNTAEKDSRASATVGGYEVIDAAKNTLEAVCPGTVSCADVVALAARDAIFFSGGPHWDVPTGRRDGLVSQASVVASNLPDPSFTVDQSTASFSAKGLSQSDLVVLSGAHTIGFAHCGAIMNRFSANGSDPTLDPTFGKMLESSCPSPSPDATKLLPLDVLSNTIFDNAYFVNLQAGKGLMSSDQALFTDPRTKPLVNAFAQNANSFSANFQLAMVRLGQVQVKTGSDGQIRKNCRAINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGAGCCTCTTTTCGTCCTGGTTCTCCAACTCTCTGCTGTATGCATTCAAGCGCAGCTGCTCGTTGGATTCTATGACAGCTCCTGCCCGAGAGCCGAGAGCATTGTGCAACAATCC
GTGATGATGGCGATCCAAAGTAATCGCCCGCTCGCATCGCGTCTAGTTCGGCTCTTCTTCCACGACTGCTTCGTGCAA
GTAAGTTTGAAGCTAGAGCTCGAGCTGCATCTGATGTCGCTA
CTCATGCCTGCGTTTTGTGCCACAGGGGTGTGACGCCTCAATCTTGCTCGACTCAACTCCAAACAACACTGCGGAGAAAGATAGCCGGGCGAGCGCAACCGTGGGTGGCTACGAGGTGAT
TGACGCCGCCAAGAACACGCTGGAAGCTGTGTGCCCCGGAACTGTGTCATGCGCAGATGTAGTAGCATTGGCGGCCAGGGATGCCATATTCTTT
GTAAGTTGATAACCTCTTTGCTCTTT
TGTTTACTGGCCACGGGCAGAGCACAGTGCATTGATTGACTGCTCTATCTCTGTTCTTTTTTGCTAGTCTGGAGGGCCGCACTGGGACGTTCCAACTGGACGGAGAGACGGCCTTGTTTC
ACAGGCTTCCGTCGTCGCCTCCAACTTACCAGATCCATCCTTTACCGTGGACCAGTCGACAGCATCTTTCAGCGCCAAGGGTCTGTCTCAATCGGACCTGGTGGTTCTTTCAG
GTGAGCA
AACGCGACTTGGTGGATGTTCTCAGTTGTGTTCACTAATCTGTGTAGGCGCTCATACCATTGGTTTTGCGCACTGTGGAGCGATCATGAATCGGTTTAGTGCCAACGGAAGCGATCCGAC
GCTGGATCCGACGTTTGGGAAGATGTTGGAGTCGAGCTGCCCGTCTCCCAGTCCAGACGCCACCAAGCTGCTGCCCCTGGATGTATTGAGCAACACCATCTTCGACAATGCCTACTTCGT
CAACTTGCAGGCGGGGAAGGGCCTCATGTCGTCGGACCAGGCGCTGTTTACTGATCCAAGGACAAAGCCGCTGGTGAACGCCTTTGCTCAAAACGCAAACAGCTTCTCTGCAAACTTCCA
GCTGGCTATGGTGCGACTGGGACAGGTCCAGGTGAAGACTGGCTCGGATGGCCAGATTCGGAAAAACTGCCGGGCAATCAATTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGAGCCTCTTTTCGTCCTGGTTCTCCAACTCTCTGCTGTATGCATTCAAGCGCAGCTGCTCGTTGGATTCTATGACAGCTCCTGCCCGAGAGCCGAGAGCATTGTGCAACAATCC
GTGATGATGGCGATCCAAAGTAATCGCCCGCTCGCATCGCGTCTAGTTCGGCTCTTCTTCCACGACTGCTTCGTGCAA
GGGTGTGACGCCTCAATCTTGCTCGACTCAACTCCAAACAAC
ACTGCGGAGAAAGATAGCCGGGCGAGCGCAACCGTGGGTGGCTACGAGGTGATTGACGCCGCCAAGAACACGCTGGAAGCTGTGTGCCCCGGAACTGTGTCATGCGCAGATGTAGTAGCA
TTGGCGGCCAGGGATGCCATATTCTTT
TCTGGAGGGCCGCACTGGGACGTTCCAACTGGACGGAGAGACGGCCTTGTTTCACAGGCTTCCGTCGTCGCCTCCAACTTACCAGATCCATCC
TTTACCGTGGACCAGTCGACAGCATCTTTCAGCGCCAAGGGTCTGTCTCAATCGGACCTGGTGGTTCTTTCAG
GCGCTCATACCATTGGTTTTGCGCACTGTGGAGCGATCATGAATCGG
TTTAGTGCCAACGGAAGCGATCCGACGCTGGATCCGACGTTTGGGAAGATGTTGGAGTCGAGCTGCCCGTCTCCCAGTCCAGACGCCACCAAGCTGCTGCCCCTGGATGTATTGAGCAAC
ACCATCTTCGACAATGCCTACTTCGTCAACTTGCAGGCGGGGAAGGGCCTCATGTCGTCGGACCAGGCGCTGTTTACTGATCCAAGGACAAAGCCGCTGGTGAACGCCTTTGCTCAAAAC
GCAAACAGCTTCTCTGCAAACTTCCAGCTGGCTATGGTGCGACTGGGACAGGTCCAGGTGAAGACTGGCTCGGATGGCCAGATTCGGAAAAACTGCCGGGCAATCAATTCTTAG

Retrieve as FASTA