Entry information : SmPrx09-2_89 (SmPrx09b_89)
Entry ID 6988
Creation 2009-09-30 (Paula Nunes)
Last sequence changes 2009-09-30 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx09-2_89 (SmPrx09b_89)
Name (synonym) SmPrx09-2_89 (SmPrx09b_89)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx09-2_89
start..stop
S start..stop
SmPrx09-1_40 711 0 1..355 1..355
SmPrx01-1_122 452 1e-160 28..331 19..323
SmPrx01-2_114 450 7e-160 28..331 19..323
SmPrx27-1_10 344 2e-118 26..343 12..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 386962..387186 225 N° 2 386704..386898 195 N° 3 386482..386647 166 N° 4 385948..386429 482
complement(join(385948..386429,386482..386647,386704..386898,386962..387186))


exon

Literature and cross-references SmPrx09-2_89 (SmPrx09b_89)
DNA ref. Phytozome 12:   scaffold_89 (387186..385948)
mRNA ref. JGI transcript:   272010
EST ref. GenBank:   FE483913.1 [Fragment]   FE483914.1 [Fragment]
Protein sequence: SmPrx09-2_89 (SmPrx09b_89)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (333)
PWM (Da):   %s   38961.89 (36661.7)  
PI (pH):   %s   7.7 (7.31) Peptide Signal:   %s   cut: 23 range:23-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRFSSALLLVFSSVFAIVSSQQELLGKVEENFYEKTCPAAERIVRDVVTSHFGRNRTVPAGLLRLFFHDCFVQGCDGSILLDASEDGSVIEKEGLPNRNSVRGFDVIDDAKTRLERVCPGVVSCADIVALAGRDAVVLVGAPDFAMPTGRLDGRISRRSEADALLPAPFFNATQLKASFAQQNLTVEDLVHLSGGHTIGRSQCQFFSNRLYNFSGGSPDPLLNPSYRAELQRLCPQNSRPTDRVTLDRASEFNFDNSYYTNLVAKNGLLTSDAVLTVDSETESIVRSFARDPDRFQLRFQKSLLKMSKLGLKSKANGEVRRRCNAINPKRMEEESSLVTAITDAITRALAFSK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCACGATTCTCAAGCGCTCTACTTTTGGTGTTTTCTTCTGTATTTGCCATTGTGAGTTCTCAGCAGGAACTTCTTGGCAAAGTGGAGGAGAACTTTTACGAGAAAACTTGTCCT
GCTGCGGAGCGCATTGTTCGCGATGTTGTCACTTCCCATTTCGGCAGGAACCGGACTGTTCCAGCGGGACTTCTTCGCTTGTTCTTCCACGACTGCTTTGTGCAA
GTATGATTGCTCTTC
TTTCGTTGATTACACTCGCATTGGTTCCTTGCCTGGATGTAACTACAGGGATGCGATGGATCCATCTTGTTGGATGCTTCGGAGGACGGCTCCGTCATTGAAAAGGAAGGTCTACCGAAC
AGGAACTCGGTTCGAGGATTTGATGTCATTGACGATGCCAAGACAAGGCTGGAGCGTGTATGTCCGGGTGTTGTTTCCTGCGCGGACATCGTGGCTCTAGCCGGAAGGGACGCAGTTGTC
CTG
GTAAGAAAGAGTTCTTAGTTCCATTCCATCACTCACTCTTGCATGCTTACGATCAGGTTGGAGCTCCAGACTTCGCTATGCCGACAGGACGTCTCGATGGAAGAATATCACGAAGGT
CGGAAGCTGATGCTCTTCTCCCGGCCCCTTTCTTCAACGCGACACAGCTCAAGGCTAGCTTCGCGCAGCAAAATCTCACCGTCGAGGACCTCGTCCACTTATCAG
GTACCGAAGGTTTCT
CTACTCCACAAATTTTCTTATCAACTTGCTCAAACAGGTGGTCACACTATTGGTAGATCACAGTGCCAGTTCTTTTCCAACAGGCTCTACAACTTCTCTGGAGGCAGCCCGGATCCACTC
CTCAACCCCTCCTACCGAGCAGAGCTGCAGCGCCTGTGTCCACAAAACTCTAGACCCACGGATCGAGTGACACTGGACCGAGCCTCGGAGTTCAACTTCGACAACAGTTACTACACAAAT
CTAGTCGCGAAGAATGGATTGCTCACGTCGGACGCGGTTCTCACAGTCGACAGCGAGACCGAGAGCATCGTGAGATCATTCGCGCGCGATCCCGACAGGTTCCAGCTGAGGTTCCAGAAA
TCTCTGTTGAAGATGAGCAAGCTCGGCCTCAAGAGCAAAGCGAATGGCGAAGTCCGGCGTCGTTGCAACGCAATCAATCCCAAGAGAATGGAGGAGGAGAGCTCGCTAGTCACTGCCATT
ACCGACGCTATAACTCGAGCTCTCGCCTTCTCCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCACGATTCTCAAGCGCTCTACTTTTGGTGTTTTCTTCTGTATTTGCCATTGTGAGTTCTCAGCAGGAACTTCTTGGCAAAGTGGAGGAGAACTTTTACGAGAAAACTTGTCCT
GCTGCGGAGCGCATTGTTCGCGATGTTGTCACTTCCCATTTCGGCAGGAACCGGACTGTTCCAGCGGGACTTCTTCGCTTGTTCTTCCACGACTGCTTTGTGCAA
GGATGCGATGGATCC
ATCTTGTTGGATGCTTCGGAGGACGGCTCCGTCATTGAAAAGGAAGGTCTACCGAACAGGAACTCGGTTCGAGGATTTGATGTCATTGACGATGCCAAGACAAGGCTGGAGCGTGTATGT
CCGGGTGTTGTTTCCTGCGCGGACATCGTGGCTCTAGCCGGAAGGGACGCAGTTGTCCTG
GTTGGAGCTCCAGACTTCGCTATGCCGACAGGACGTCTCGATGGAAGAATATCACGAAGG
TCGGAAGCTGATGCTCTTCTCCCGGCCCCTTTCTTCAACGCGACACAGCTCAAGGCTAGCTTCGCGCAGCAAAATCTCACCGTCGAGGACCTCGTCCACTTATCAG
GTGGTCACACTATT
GGTAGATCACAGTGCCAGTTCTTTTCCAACAGGCTCTACAACTTCTCTGGAGGCAGCCCGGATCCACTCCTCAACCCCTCCTACCGAGCAGAGCTGCAGCGCCTGTGTCCACAAAACTCT
AGACCCACGGATCGAGTGACACTGGACCGAGCCTCGGAGTTCAACTTCGACAACAGTTACTACACAAATCTAGTCGCGAAGAATGGATTGCTCACGTCGGACGCGGTTCTCACAGTCGAC
AGCGAGACCGAGAGCATCGTGAGATCATTCGCGCGCGATCCCGACAGGTTCCAGCTGAGGTTCCAGAAATCTCTGTTGAAGATGAGCAAGCTCGGCCTCAAGAGCAAAGCGAATGGCGAA
GTCCGGCGTCGTTGCAACGCAATCAATCCCAAGAGAATGGAGGAGGAGAGCTCGCTAGTCACTGCCATTACCGACGCTATAACTCGAGCTCTCGCCTTCTCCAAGTAA

Retrieve as FASTA